a doctor sees a patient who has kidney failure, lack of motor coordination, and a poorly functioning nervous system. after testing the doctor finds that these symptoms are all related to a chronic lack of energy in some of the patients cells. the doctor diagnoses a metabolic disorder known as leigh's disease. Based on evidence a malfunction in what organelle is most likely responsible for leighs disease?

Answers

Answer 1

prerenal inflammation im pro

bably wrong i just wanted to answer something


Related Questions

Clever ones this is one for you

If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.​

Answers

Answer:

so please Indicate your question

What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic

Answers

Answer:

D

Explanation:

What is the independent variable?

What is the dependent variable?

Answers

Answer:

the independent is the age of the tree and the dependent is the diameter

Explanation:

the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is

Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)

The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.

Help I need helpppppppoo

Answers

meters per second. distance is meters and time is seconds
meters per second I’m right

which type of cell does the strainer best model?

Answers

Answer:

D

Sieve tube element, because it has openings that allow materials to pass through its end walls.

Answer:

D. Sieve tube element, because it has openings that allow minerals to pass through its end walls

Explanation:

I'm taking the test right now, I hope this helps

MARKING PEOPLE AS BRAINLIDT IF CORRCET

True or False: Bone cells contain different DNA than blood cells.

Answers

Answer:

True the bone cells do have different DNA than blood

Explanation:

True.
bone cells and blood cells do different things, hence the different DNA

plz help me i beg of you!???

Answers

Answer:

Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.

Explanation:

the combination of a heart arteries and veins and capillaries is____​

Answers

Answer:

A (an organ system)

Explanation:

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration

Answers

Answer:

D. In mitochondria, during cellular respiration.

Explanation:

A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.

All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.

Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.

Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.

In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.

Answer:

D

Explanation:

got it right on edge

The pigment plants have that they use for photosynthesis is called ————

I don’t want a explanation I just want the answer


Answers

Answer:

chlorophyll is the answer

What might be the consequences of your choice?
• Political:
• Economic:
• Social:

Answers

Answer:

Political: Lobbyists.

Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.

Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.

Explanation:

3.4.3 Lab: Why are cells so small?

Answers

Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.

Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.

The cells are so small because their small size allows them to take in food and get rid of the waste.

The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.

Learn more about cell:

https://brainly.com/question/3142913

ALOT OF POINTS PLEASE HELP :)

How did humankind discover the presence of DNA?

Answers

Answer:

The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.

Explanation:

a sedimentary rock formed from clay deposits

Answers

Answer:

is it shale

sorry if that's not right it's kinda confusing how you put the question

Explanation:

PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP

Answers

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Answer:

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Explanation:

Hope This Helps!

Please Mark Me Brainly!

Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II

Answers

Answer:

Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8

Explanation:

I learned this a while ago so I would know

which of the following are part of the central nervous system?​

Answers

Answer:

The central nervous system is made up of the brain and spinal cord

Explanation:

ion if that's the answer you were looking for but here go.

Whats the answer giving brainliest HELP!!!!!

Answers

Answer:

I feel like the first one is the best

Explanation:

widening the roads will just cause more cars.

raising the price is most likely not gonna help but its an option.

expanding just means more cars

How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA

Answers

Answer: Complementary base- pairing creates a very stable structure

Explanation:

The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.

A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.

In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).

Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.

Read more: https://brainly.com/question/19755749

15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations​

Answers

Answer:

C. Somatic

Explanation:

hope it helps ya :D

When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used

Answers

Answer:

Pretty sure its b.

Explanation:

which statement describes what happens to rocky shorelines that absorb energy from ocean waves?

Answers

Answer:

Solid rock break apart

Explanation:

During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply​

Answers

Answer:

hi love you have a nice day      

Explanation:

Please help I will give a brainliest

Answers

Answer:

answer

Explanation:

im not that good w these sorry

18. How has the use of herbicides affected agricultural productivity?
O A. Fewer crops are organic because of the use of Bt toxin.
B. Fewer pesticides are needed because of parasitoids.
O C. Fewer people are needed to weed because of herbicides.
D. Fewer crops are produced because of herbicides.

Answers

Answer:

B. Fewer pesticides are needed because of parasitoids.

Explanation:

Herbicides are chemicals utilized to manage or command unwanted vegetation. Herbicide employment happens most commonly in row-crop cultivation, where they are employed before or throughout seeding to maximize yield productivity by decreasing other vegetation.  Yields have improved considerably, and, in association with tillage, herbicide use decreases erosion, fuel usage, greenhouse gas discharges, and nutrient run-off, and preserves water.

explain how water properties help get water from the roots of plants to leaves

Answers

Answer:

In order for water to move through the plant from the soil to the air (a process called transpiration), soil must be > root > stem > leaf > atmosphere. ... Because of this difference in water potential, water will move from the soil into a plant's root cells via the process of osmosis.

Explanation:

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

(I will give a Brainliest) Can liquid water and steam exist at 100°C?

Answers

Yes It can.

Hope it helps (:

Answer: yes it can!

Explanation: hope you get a good grade!

in what form is carbon found in the atmosphere?

Answers

Answer:

carbon dioxide(CO2)

Methane gas(CH4)

Explanation:

Answer:

CO2

Explanation:

Other Questions
what is tetra atomic molecules? Please help writing assignment Need this very badly I am giving all my final points for this one please answer correctly! and thank you what is the charge on a calcium (Ca) atom that contains 18e? 15) The baseball coach bought 6 new baseballs for $1.20 each. The basketball coachbought 5 new basketballs for $9.10 each. How much more did the basketball coachspend than the baseball coach? Explain and Show the equation of line parallel to y=-1x+2 going through the point (6, 3) PLS HELP ME I DIDNT EVEN STUDY FOR MY TEST TODAY. I'LL GIVE BRAINLIST!!!!!!!$3,600 is deposited in to an account that earns 4.5% interest, compounded annually, for 4 years. Calculate the total balance at the end of 4 years. Round to the nearest cent. Which point represents the fourth bus stopA. (11,8)B. (13,12)C. (15,10)D. (19,12) Determine if the sequence is an arithmetic sequence. If it is, then find thecommon difference.73, 68, 63, 58, 53, Caroline needed to get her computer fixed. She took it to the repair store. Thetechnician at the store worked on the computer for 2.75 hours and charged her $114for parts. The total was $320.25 when do differences become conflicts PLEASE ASNWERSimplify the following.-(33)2 How does the structure of DNA explain chargaff's rule? What role did the railroads play in bringing immigrants to theUnited States and to Washington? PLEASE HELP ME FAST I NEED HELP PLEASE Can this be expressed as a unit rate? PLEASE BE RIGHT!! YOU MUST BE 100% SURE!!Enrico runs 100 meters in 15 secondsA television station shows 15 commercials in 1 hour Losing weight slowly is the healthiest way. TrueFalse Find the applied voltage of a telephone circuit that draws 0.017A through a resistance Of 5,000 ohms Ken wants to jump and have some fun too! Barbie loans Ken her bungee cord. Is this a good idea? Explain with evidence and reasoning. (barbie bungee jump lab)