7. B=brown eyes
b= blue eyes
What is true about these two brothers that have brown eyes:
One has genotype BB the other Bb.
a. they have same phenotype and genotype
b. they have different genotypes and phenotypes
c. they have same phenotype but different genotypes
d. they have same genotype but different phenotypes

Answers

Answer 1
C definitely c hope this helps
Answer 2

The truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb). So, the correct option is C.

What do you mean by Genotypes?

Genotypes may be defined as a given set of alleles that an individual possesses. They are ultimate combinations of alleles.

In this situation, the allele B is dominant over the allele b, therefore, in both cases, phenotypes remain the same i.e. Brown eyes, but the genotypes differ. This defines how an allele interacts with another allele and changes the genotype.

Therefore, the truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb).

To learn more about Gene interaction, refer to the link:

https://brainly.com/question/25217589


Related Questions

Which of the following processes cycles matter through different parts of an ecosystem?
More than one answer may be correct.
1. the nitrogen cycle
2. the water cycle
3. the carbon cycle

Answers

Answer:

the nitrogen cycle, the water cycle, and the carbon cycle

Explanation:

The water, carbon, and nitrogen cycles move nutrients through the different parts of an ecosystem. Water moves through organisms and the environment in different phases. Carbon moves through an ecosystem in carbon dioxide, minerals, and organic compounds. Nitrogen moves through an ecosystem in nitrogen gas, ammonium, nitrates, and organic compounds.

The biogeochemical cycle is a pathway that circulates the chemicals through the abiotic and the biotic factor. The nitrogen, water, and carbon cycle through various regions of an ecosystem.

What is a biogeochemical cycle?

The biogeochemical cycle is the movement of the chemicals and compounds of carbon, nitrogen, and water in the biosphere (biotic) and the atmosphere, lithosphere, and hydrosphere (abiotic) spheres of the earth.

These cycles move the nutrient through different spheres in the form of inorganic and organic compounds. It is an essential part of the ecosystem as they regulate the flow of the natural elements.

Therefore, option 1. nitrogen cycle, option 2. water cycle, and option 3. carbon cycle move through various parts of an ecosystem.

Learn more about biogeochemical cycles here:

https://brainly.com/question/1204069

#SPJ2

What two elements of weather are affected by air masses

Answers

Answer:

The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.

Cold fronts and warm fronts

how do gray whales migrate?

Answers

Answer:  Grey whales travel 12,000 miles round-trip from their feeding grounds in the Arctic to calve and breed in the Baja lagoons, and then back again.

Explanation:

(GIVING BRAINLIEST!!)


James made the following table to compare the common characteristics of planets. Which of the following would best replace X?


A) Asteroids

B) Comets

C) Moons

D) Stars

Answers

Answer: moons

Explanation:

Mars and Neptune both have moons

Answer:

hi answer is moons

Explanation:they have moons :)

Which ecosystem most likely has the greatest biological diversity and therefore the highest sustainability A. A tank that includes several goldfish B. Tundra region that has many penguins C. A pine tree in which three groups of birds live D. A rainforest that has many different types of plants and animals

Answers

Answer:

definitely D because a rainforest is extremely vast when it comes to different species

Explanation:

brainliest plz?

The ecosystem which is most likely has the greatest biological diversity and therefore the highest sustainability is a rainforest that has many types of plants and animals. Therefore, the correct option is D.

What is ecosystem?

An ecosystem refers to the biological community where the biotic as well as the abiotic components interact with each other and influence each other.

It encompasses all the living organisms in a specific area as well as physical and chemical factors that shape their environment such as air water soil climate and environment. They play an important role in functioning the earth's biosphere, as they provide a range of essential services.

The study of ecosystem and interaction between is components is referred to as ecology. Hence, the correct option is D.

For more details regarding ecosystem, visit:

https://brainly.com/question/15011558

#SPJ6

please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?

Answers

Answer:

A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.

What are the advantages and disadvantages of a honey bees sexual reproduction

Answers

Answer:I just learned this.

Explanation: The Advantage is that they have plant pollination and honey.

How many chlorine atoms are there in the molecule NiCl2

Answers

Answer:

2, that’s what the 2 means.

Explanation:

Which model below shows a prokaryotic cells?

Answers

Answer:

Modle two as it is singular, simple with a flagellum

Explanation:

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

According to Vince Carter, "...the most important aspect of getting his degree was the sense of accomplishment it brought. " Use information from the selection and your own ideas to explain what he meant by this statement.

Answers

Answer:

the hard work he went through

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Read more about organisms

https://brainly.com/question/25832580

Answer:

While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.

Explanation:

The answer explains itself. It is accurate information. :) Have a good day!

Which of the following solutions is neutral?


Group of answer choices


a solution with a pH of 14


a solution with a pH of 2


a solution with a pH of 7


a solution with a pH of 9


Flag this Question

Question 4

Potassium hydroxide has the chemical formula KOH. It feels slippery and is used in cleaning liquids. Based on this description, potassium hydroxide is most likely a(n)?


Group of answer choices


acid


base


neutral solution


pH indicator








first to answer gets the brinllest

Answers

Answer:

Kleenex

ekekkdkdkeeee

How could one determine if two
unidentified organisms share a common
ancestor?

Answers

Answer:

Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.

Explanation:

DNA

They can look at the DNA it's the most common one.

There are 4 pieces of evolution and they are

Fossils , Geography , Embryos / DNA , Anatomy

Fossils: Physical remains of species , Determine age, location,  environment

Deeper layers = older

Geography: Proves species share common  ancestors, depending on where

they live

DNA: BEST evidence because it’s the  MOST ACCURATE

Similarities in the early stages of  development

Similarities in DNA

More similarities = closely related

More differences = not related

Anatomy: Compare body parts of different  species to see how they evolved

3 different structures:

Homologous (same structure,  different function)

Analogous (similar structure,  different organisms)

Vestigial (body parts that no  longer serve a purpose)

All of that are in evolution

Hope it helped! ( Gave u my biology notes :D)

How does the size of a bacterial cell compare with an animal cell?

Answers

Answer:

hope it helped

Explanation:

Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.​

Answers

It made it possible to actually see cells. Explanation: With the development and improvement of the light microscope, the theory created by Sir Robert Hooke that organisms would be made of cells was confirmed as scientist were able to actually see cells in tissues placed under the microscope.

Thank You so Much

your amazing have a great life

A molecule of oxygen gas contains two:
O molecules
O elements
O atoms

Answers

Answer:

O atoms

Explanation:

:)))

A molecule of oxygen gas contains two atoms of oxygen bonded together.

Answer: your answer will be C

A _______________ from the sun hits chlorophyll and excites an electron, known as __________________________________.

Answers

Answer:

Photon, light dependent reaction of photosynthesis

Explanation:

Photosynthesis is the process by which green plants make their own food in the presence of sunlight and water.

There are two steps of Photosynthesis that include light dependent reaction and light-independent reaction.

In light dependent reaction, a photon from the sun is absorbed by the green pigment in leaves called chlorophyll that allow the electron to excite from ground energy level to high energy level. It converts the solar energy into chemical energy and called light dependent reaction of photosynthesis.

Hence, the correct answer is "Photon, light dependent reaction of photosynthesis".

As scientists advise about potential risks due to climate change, many coastal areas are preparing for a higher risk of impact Predict
which of these has a greater impact on human health in coastal areas due to climate change.

Answers

Since the coast water is rising,it would be hard to find fresh water. The people would not be able to use the water,because it would be contaminated with bacteria. If all of the ice does melt,most of the fresh water will turn to salt water,and we would have to adapt to a new way of life. People would have to live on higher land,there would be no one to grow crops,and their would be no way that trees would survive,meaning we would not be able to breathe.The worst part of this all is that the Earth's temperature will sky rocket,and it will be so hot,the Earth will kinda be like a huge hurricane.(lol)

Hope this helped and good luck!

-Nea

Answer:

C.  Increased severity of tropical storms

Explanation:

Due to increased water temp and increased evaporation

What is the function of a phospholipid bilayer

Answers

Answer:

Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.

Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.

What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]

When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.

Are gender traits completely a result of societal expectations?

Answers

Answer:

No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.

⦁ In what stage of an animal’s life cycle do most cells differentiate?

Answers

Answer:

Reproduction

Explanation:

Answer:

Animals and plants produced by sexual reproduction begin life as a single cell, a fertilised egg or zygote . These cells must divide by mitosis to produce a multicellular organism.

In this lab, you will simulate birds with three
different beaks. After watching the birds feed, you
will remove fruit to simulate a change in the
environment. What question are you answering by
doing this observation? Write it by filling in the
blanks below.
What is the effect of

on..

Answers

By looking at how the birds interact with fruits in different environment, you can determine where birds are from, what beaks specialize in eating what kind of food, and how those traits came to be (Darwinism)

Answer:

1.

The independent variable is the type of food available.

2.

The dependent variable is the frequency of each type of beak (or number of birds with each beak type).

Explanation:

ong

When is carbon dioxide released during aerobic cellular respiration?

Answers

Answer:

I hope this helps and rate it if its right

Explanation:

I hope this helps and rate it if its right

PLEASE HELP QUICK Each cell of a human male normally contains _____. A. One X chromosome and one Y chromosome B. Two X chromosomes C. One X chromosome and two Y chromosomes D. Two Y chromosomes

Answers

Answer:

The answer is A.

Explanation:

how does the respiratory and digestive system work together to maintain homeostasis

Answers

You have four main types of tissues: epithelial, nervous, muscle, and connective tissue. Epithelial tissue covers the outside of the body. It also lines organs and cavities. Nervous tissue sends electrical signals. Muscle tissue helps you move. Connective tissue joins bones and cushions organs.
When groups of tissues work together, they are called organs. Some
examples of organs are the heart, lungs, skin, and stomach. When organs work together, they are called systems. For example, your heart, lungs, blood, and blood vessels work together. They make up the circulatory system.
There are eleven systems in the human body: muscular system, respiratory system, digestive system, integumentary system (skin), skeletal system, circulatory (or cardiovascular) system, excretory (or urinary) system, reproductive system, nervous system, lymphatic system, and endocrine system. Each system has a special job.
All of your body systems have to work together to keep you healthy. Your bones and muscles work together to support and move your body. Your respiratory system takes in oxygen from the air. It also gets rid of carbon dioxide.
1
2
3
4
5
6
Your digestive system absorbs water and nutrients from the food you eat.
Your circulatory system carries oxygen, water, and nutrients to cells throughout your body. Wastes from the cells are eliminated by your respiratory system, your excretory system, and your skin. Your nervous system controls all these activities with electrical impulses. If any system in your body isn't working properly, other systems are affected.
Think of your body as a building. A building has a plumbing system, a heating system, a cooling system, an electrical system, and a support system. If any system in a building breaks down, other systems can be affected.
As one example, think about a building's electrical system. Suppose a mouse chewed through an electrical wire to a furnace. Without electricity, the heating system would not work. If this happened in very cold weather, the plumbing system could be affected. Water pipes might freeze and burst. If a lot of water leaked into the building's walls, its support system would be damaged. Like a building's systems, your body's systems have to work together.
HERE IS UR ANSWER MATE!.....

The respiratory system brings oxygen into the lungs when you breathe. The digestive system breaks food down into nutrients such as glucose. Now the circulatory system enters the picture. It transports glucose and other nutrients from the digestive system to the cells.

HOPE IT HLPS UH WELL

What are 3 lines of evidence that corroborate the theory of evolution?

Answers

Answer:

Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.

Explanation:

I majored in Biology

Describe what occurs during normal cell division.

Answers

Answer:

mitosis

Explanation:

Mitosis the process of cell division where a cell complete spits itself into 2 daughter cells with the same number of chromosomes as the parent cells it has 2 major parts

Answer: Mitosis

Explanation: other words for it is normal cell division, this is a normal occurrence

Other Questions
PLEASE HELP!!! :(I WILL MARK BRAINLIEST18 POINTSWhich revision corrects the inappropriate shift in verb mood?Evan got a job at the pet store down the street from his house. He thought he'd get to spend his days petting dogs and kittens and maybe learning how to wrap snakes around his neck like he'd seen in the movies. Did he find out that his job was more about cleaning dirty cages and trying to keep small children from poking the parrots? Once he'd been there a few weeks, he got pretty fast at cleaning the cages and saving kids' fingers, so he was finally able to spend some time with the cats and dogs. Hismanager, however, still wouldn't let him play with the snakes.A. Would he find out that his job was more about cleaning dirty cagesand trying to keep small children from poking the parrots?B. Clean the dirty cages and keep the small children from poking theparrots.C. He finds out that his job was more about cleaning dirty cages and trying to keep small children from poking the parrots.D. He found out, though, that his job was more about cleaning dirtycages and trying to keep small children from poking the parrots. For the past ten years, Michelle has been tracking the average annual rainfall in Boynton Beach, Florida by recording her data in the given table. She has concluded that the relationship can be modeled by a linear function. Year 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 Average Rainfall(in inches) 62.33 61.8 61.27 60.74 60.21 59.68 59.15 58.62 58.09 57.56Use the values provided in the table to create a linear graph of the data. On the graph, let represent the year 2004. Be sure to include all proper labels on the graph. plz help me out with this [tex] \frac{3 {c}^{3}d }{9c {d}^{ - 1} } [/tex]I dont really understand how to do this fully. I just need to simplify it. tan+sec=3can someone solve this by finding all answers as the nearest whole degree short essay your teacher have provided you At a swimming race, 3 out of 10 swimmers won a ribbon. What percent of the swimmers won a ribbon? Introduction ModelWhy do archaeologists believe that our ancestors did not migrate to other continents from the coastal region? For khan academy. Need help . Explain if you can please help!!!!!I am in needd Attempt 1 of 2In the word-square find ten modes of transportation inSpanish. The words may read vertically, horizontally ordiagonally What do you think would be an economic(money) reason a country would take over another? What do you think would be a religious reason? True or False: Each cabinet member must be approved by the U.S. Congress.A. TRUEB. FALSE Solving One Step Equations. SHOW YOUR WORK -6 = b/16 solve to find b A store pays $13 for a bicycle helmet and marks up the price by 40% what is the amount of the mark-up? What are the common factors of 8 and 16 how many string object are in 128,55 in python What is the key activating signal in the TNF receptor signaling pathway that occurs downstream of TNF-alpha binding to the extracellular domain Find the commission. Which word in this passage is an intensive pronoun? The fancy new dog food that my veterinarian recommends costs $20 per bag. For that price, I might just eat it myself! O A. it O B. that O c. myself OD. I