6 lots of 3 is 6 more than 5 lots of 3​

Answers

Answer 1
No because 6*3 is 18 5*3 is 15 so it would be three more instead of five

Related Questions

what number is 0.001 more than 437.999

Answers

Answer:

437.999 + 0.001 = 438

Step-by-step explanation:

Solve the following equation algebraically:

5x2 = 60

a. x~+3.46
b. x~3.46
c. x = 12
d. x =+12


Please select the best answer from the choices provided​

Answers

Answer:

A. X~+3.46

Step-by-step explanation:

I calculated logically

14. Quadrilateral ABCD is located at A(2,0), B(3,-4), and C(7,-5). What are the
coordinate of point D that makes the quadrilateral a rhombus?
PLEASE HELPPP

Answers

Answer:

A

Step-by-step explanation:

A rhombus is a quadrilateral whose four sides all have the same length. if you look at the picture I sent, A(6,-1) forms a rhombus where all of the sides are an equal length.

Draw a quadrilateral that is similar (but not congruent) to the one given below. Measure and label all sides and angles of quadrilaterals and ′′′′. Write a similarity statement.

Answers

Answer:

draw the same shape but multiply all the sizes to be bigger or smaller

Can some one help me please

Answers

Answer:

B

Step-by-step explanation:

x+2+10 is 13 which is the beginning of the perimeter

I think it’s B I’m not for sure

n+3 +n for n = 6 Can you help

Answers

Answer:

15

Step-by-step explanation:

If I am not mistaken, since n is 6 you would replace n with 6 so it would be 6+3+6= 15.

I hope this helps :)

The answer to this would be 15.
I hope this helps

The math clubs car can travel 9 meters in a second. The race track for the soap box derby is 63 meters long. How many seconds will it take the Math clubs car to make it around the track

Answers

Answer: it will take 7 seconds

Step-by-step explanation: 9 x 7 = 63

A giant tortoise moves at a slow but steady pace. It takes
the giant tortoise 3 seconds to travel 10.5 inches.
How many inches will the tortoise travel in 1 second?

Answers

the answer should be that it will take the tortoise 1 second to travel 3.5 inches

Help me i don't understand this and i need a answer fast <3

Answers

Answer:

what grade r u in?

Step-by-step explanation:

pls help !! - Using the graph below, what is the rule for a translation form point A to point D?

Answers

The answer is b trust me I got this one right

Answer:

B

Step-by-step explanation: i took the test on docs/forms

the price of a sweater was reduced from 20$ to 12$ by what percentage was the price of the sweater reduced

Answers

Answer:

11%

Step-by-step explanation:

the answer is 11 because you need to minus

11% okkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk

People tend to evaluate the quality of their lives relative to others around them. In a demonstration of this phenomenon, Frieswijk, Buunk, Steverink, and Slaets (2004) conducted inteviews with frail elderly people. In the interview, each person was compared with fictitious others who were worse off. After the interviews, the elderly people reported more satisfaction with their own lives. Following are hypothetical data similar to those obtained in the research study. The scores are measures on a life-satisfaction scale for a sample of n = 9 elderly people who completed the interview. Assume that the population average score on this scale is μ = 20. Are the data sufficient to conclude that the people in this sample are significantly more satisfied than others in the general population? Use a one-tailed test with α = .05. The life-satisfaction scores for the sample are 18, 23, 24, 44, 19, 27, 23, 26, 25.

Answers

Answer:

we reject H₀

We have enough evidence to claim that people in the sample are significantly  more satisfied than others in general population at 95 % of CI

Step-by-step explanation:

Population mean    μ₀  = 20

Sample data   18  23  24 44  19 27 23 26 25

Then:

Sample mean      μ   =  25,44

Sample standard deviation     s = 7,14

Sample size     n  =  9

Hypoyhesis test:

Null hypothesis                                H₀              μ   =   μ₀

Alternative hypothesis                   Hₐ               μ   >   μ₀

Significance level    α  = 0,05    CI = 95 %

We must develop a  t-student one-tail test  ( to the right ) as follows

t(c)  =  ??

degree of freedom    df = n - 1         df =  8      and    α = 0,05

Then from t-student table    t(c)  =  1, 8595

To calculate   t(s)  =  (  μ  -  μ₀  ) / s/√n

t(s)  =  ( 25,44  -  20 ) * √9 / 7,14

t(s)  = 5,44*3 / 7,14

t(s)  = 2,29

Comparing   t(c) and  t(s)

t(s)  >  t(c)

Then t(s) is in the rejection region   we reject H₀

We have enough evidence to claim that people in the sample are significantly  more satisfied than others in general population at 95 % of CI

Please help me with this question

Answers

Answer:

5 x 3/4 < 5

2 x 4/3 > 2

6 x 5/5 = 6

4/7 x 1/8 < 4/7

2/5 x 7/7 = 2/5

1/3 x 6/4 > 1/3

Simplify:
3 [23 + (4 – 2)3 – (6 - 2)2]
A. 3

B. 12
D. 24

E-3

Answers

Answer:63

Step-by-step explanation:

Beth is making fruit salad. She adds 4 grapes for every 2 strawberries. If she uses 20 strawberries, how many grapes will she use?

Answers

Answer:40

Step-by-step explanation:2x+4x where the 4 represents every clump of 4 grapes and the 2 is strawberries

What is the autput the following machine when the intut is 4

INPUT--------》Subtract7----------》Divide by 3----------》OUTPUT​

Answers

Input is 4.

Process machine:

Input > - 7 > ÷ 3 > Output

Solve:

(Input) 4 - 7 = -3

          -3 ÷ 3 = -1 (Output)

Input = 4

Output = -1

Answer:

-1 (negative 1)

Step-by-step explanation:

The input, which is 4 minus 7 is -3. -3 divided by 3 is -1.

Which means the output will be -1 if the input is 4.

Hope it helps

Have a great day

The Econ motel charges $260 for 4 nights, how much would they charge for 7 nights?

Answers

Answer:

$455

Step-by-step explanation:

To find the answer, divide 260 by 4 to find the cost of one night. This gets us 65. Now, we multiply 65 by 7 to get 455. This means it costs $455 for 7 nights.

Answer:

$455

Step-by-step explanation:

260 divided by 4 is 64

64 times 7 is 455

PLEASE HELP ASAP!!!!

Answers

A and B are polynomial. E,D,C are not because polynomial can’t have a negative exponents, or a division by a variable.

You are purchasing a car for $12,465.00 plus 5.65% sales tax. You make a $1,300.00 down payment and have a fair credit score. If you improved your credit score to good and paid $1,500 on your purchase, how much interest could you save in the first month?

Secured Unsecured
Credit APR (%) APR (%)
Excellent 4.75. 5.50
Good 5.00 5.90
Average 5.85 6.75
Fair 6.40 7.25
Poor 7.50 8.40



$13.25


$14.68


$21.74


$25.69

Answers

Answer:

21.74

Step-by-step explanation:

Seventh grade
AA.5 Area of circles YA8
The radius of a circle is 9 feet. What is the circle's area?
Use 3.14 for .
square feet
Submit

Answers

Answer:

A=pi x r^2

A= 3.14 x 9^2 feet

A= 3.14 x 81 feet^2

A= 254.34 ft^2

Find the point that maximizes the objective functions P=2x+5y using constraints:
y>=10-2x
y<=7-1/2x
x>=0
y>=0​

Answers

Answer:

(2,6)

Step-by-step explanation:

3/2+b=7/4 what is the value of B

Answers

b = 1/4

b = 0.25

Move all terms not containing  b  to the right side of the equation.

Answer:

b=1/4

Step-by-step explanation:

Draw 9:10 on a clock

Answers

Answer:

put the short hand at nine

Step-by-step explanation:

put the long hand and 10 minutes

Answer:

you can draw on your notebook and draw the clock

PLEASE ANSWER ASSAP!!!!!!!!!!!!!!!! WILL GIVE BRAINLEST!!!!!!!!!!!!!!!!!!!

Answers

Answer:B

Step-by-step explanation:

Vertical angles are equal, so 4x - 20 = 60

28
6. Hannah has 229 horse stickers and
164 kitten stickers. How many more
horse stickers than kitten stickers does
Hannah have?

Answers

Subtract 229 and 164 its 65 so thats your answer .

3x + y = 15 and y = 2x
The solution, given in (x,y) form is

Answers

Answer: (3, 6)

Step-by-step explanation:

3x + y = 15

y = 2x

Using substitution:

3x + 2x = 15

5x = 15

x = 15/5

x = 3

y = 2x

y = 2 * 3

y = 6

x = 3

y = 6

= (3, 6)

eden purchased a home for $156,200. The home appreciates about 4.5% each year. what is the value of the home after 17 years?

Answers

Answer:

590,088

Step-by-step explanation:

So you divide 156,200 by 4.5 then once you have that times it bye the 17 years I think

PLEASE HELP!!!! ❗❗❗❗❗❗❗
I NEED THE ANSWER TO THIS ASAP!!! PLS HELP!!! question below ;-;

the track team is trying to reduce their time for a relay race. First they reduced their time by 2.1 minutes. Then they are able to reduce that time by 1/10. If their final time is 3.96 minutes, what was their beginning time? Show or explain your reasoning.

Answers

Answer:

6.27 minutes

Step-by-step explanation:

3.96+2.1=6.06

1/10=0.1x2.1=0.21+6.06=6.27

Solve the inequality

Answers

Answer:

x ≥ -64

Step-by-step explanation:

"3/4ths of a number is greater than or equal to -48"

3/4 of a number ≥ -48

Let's say the number is x.

(3/4)x ≥ -48

Multiply both sides by 4.

3x ≥ -192

Divide both sides by 3.

x ≥ -64

HELPPP PLASE ITS DUE REALLY SOOOONNNNNNNNNNNN!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

4 sorry of its not right
Other Questions
A similarity between Woodrow Wilson and Theodore Roosevelt was that bothO believed monopolies were bad for the country.O kept the United States out of foreign wars.O were candidates for two different parties.O were strong champions for the environment Select the sentence that contains a noun clause. BRAINLIST Leah spent three times the amount Damean spent on CDs. Damean spent $33.87. How much did Leah spend on CDs? 6 is 16% of what number? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Explain the role that Benjamin Franklin played during the American Revolution.. After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? answer the pic below