If you are referring to all to the bald eagles in an area you are talking about a species.
All the bald eagles that are occupying one area are having the same characters and features. It is referred to as species residing in a habitat.
What is habitat ?It is defined as the number of species living together and residing in one particular type of area that is together termed as habitat.
Species is defined as the type of category of the species that are living in one area that are living together in order to make a community together and mostly do not depend on each other.
Individual is a part of the community. It is referred to as a single person living in one area such that he alone is depending on the other resources for the dependence.
Learn more about population at :
https://brainly.com/question/27779235
#SPJ2
plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion
Can you give me a slogan for using compost at home
Answer:
Mark my answer the brainliest if this helps,
A Partner with the Environment.
Because What You’ve Got is Not Waste.
Clean Up Your Act. Compost.
Compost On Your Mind?
Don’t Burn Our Future.
Eat Smart
Enriching the Soil Naturally.
Feed the Soil.
Fit Energy Saving Light Bulbs
Give Green a Chance
Greening the Hill.
It’s Easy to Do.
Lets Talk Dirty.
Local Composting Made Easy.
Making a Clean Scene.
Making a Compost Pile
Mother Nature Recycles.
Nature’s Way to Grow.
Plant a Garden
Plant Trees
Raking Leaves
Recycle All Recyclable Items
Recycle Your Grey Water
Reduce The Use of Energy
Replenish the Earth for Generations.
Reuse Stuff
Reuse Whatever You Can
Reuse, Reduce and Recycle
Save Water To Save Money
Shoveling The Driveway
Smells Like Green Spirit
So Hot Right Now.
Sustainability Stools.
The Compost People.
The Solution to Sustainable Soil and Water.
Think Before You Buy
Too Good to Waste.
Turn It Off When Not In Use
Use Less Electricity
Walk To Work or Take The Bus
Waste Wise.
We Speak Organic.
We’re Growing.
Zero Waste.
Answer:
mark ssydnie the brainliest
Explanation:
can u answer that question
Answer:
The synthesis of new proteins
Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another
answer: yes
exanation:
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Which is an example of the use of plants in human societs?
Answer:
|
v
Explanation:
photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.
"CRISPR" stands for Clustered Regularly Interspaced Short Palindromic Repeats, which are the hallmark of a bacterial defense system that forms the basis for CRISPR-Cas9 genome editing technology. In the field of genome engineering, the term "CRISPR" or "CRISPR-Cas9" is often used loosely to refer to the various CRISPR-Cas9 and -CPF1, (and other) systems that can be programmed to target specific stretches of genetic code and to edit DNA at precise locations, as well as for other purposes, such as for new diagnostic tools. How can this tool be used to alter genes in various organisms?
Answer:
by designing short guide RNAs (sgRNAs) customized to target genes of interest in the cells of these species
Explanation:
The CRISPR-Cas9 editing system is a versatile and powerful genome engineering tool for editing genomes, which can be directed to alter almost any DNA sequence in order to modify gene function. This system consists of an endonuclease protein (Cas 9) that cuts DNA at specific sites guided by a short guide RNA (sgRNA), which binds by base complementarity to the target sequence. This sgRNA must be designed with efficiency and specificity to target genes of interest. In consequence, the CRISPR-Cas9 genome editing system produces DNA double-strand breaks which may be repaired by 1- error-prone nonhomologous end joining (NHEJ) or 2-homology-directed repair (HDR) DNA repair pathways. According to the DNA repair pathway that has been activated, it is possible to trigger genetic modifications in the cells of different species (i.e., plant cells, animal cells, human cells, etc).
What do RNAs do in the cell?
Group of answer choices
Answer:
A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.
Explanation:
None
The movement of water in or out of the cell membrane without the use of ATP.
Diffusion
Facilitated diffusion
Osmosis
Excoytosis
I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)
In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.
Answer:
Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.
I tried my hardest and this is what I put on MY test so good luck
which of the following is not true about an allele?
A. alleles are found at the same place on a chromosome
B. alleles have a dominant and recessive form
C. an allele is never independently assorted and passed down randomly
D. and allele is one of two or more forms of a gene
Answer:
C
Explanation:
I guess it's C but not conform
C. An allele is never independently assorted and passed down randomly.
What is an allele?Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.
However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.
Learn more about allele, here:
https://brainly.com/question/14206531
#SPJ2
When discussing Newton’s laws of motion, which terms do people most likely use when talking about Newton’s third law of motion?
A. “action” and “reaction”
B. “mass” and “inertia”
C. “inertia” and “force”
D. “force” and “acceleration”
Answer:
A. action and reaction
Explanation:
the third law is:-
Every Action has it's opposite and equal Reaction
Answer:
The correct answer is "action" and "reaction".
Explanation:
Newton's Third Law is: "for every action, there is an equal and opposite reaction". This means that every time something is pushed on, the other object pushes back. For example, when a swimmer pushes off the wall of a pool, the wall will push back on the swimmer, giving them the push they need to swim to the other side.
Adhesion occurs when water is attracted to other polar substances. Which of the following is an example of adhesion in organisms?
a. Capillary action of liquid in plant stems b. Release of sweat to reduce body heat
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system
Answer:
a. Capillary action of liquid in plant stems
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system
Explanation:
Hope this helped!
In organisms, an important example of adhesion is the: a. Capillary action of liquid in plant stems.
What is Adhesion?Adhesion can be described as the attraction that occurs between molecules as a result of molecular mechanism, which is also known as capillary action.
In plants, capillary action occurs when the molecules of water cling to the xylem cell walls. This is known as adhesion.
Therefore, an example of adhesion in organisms is: a. Capillary action of liquid in plant stems.
Learn more about adhesion on:
https://brainly.com/question/14457491
#SPJ2
What are common changes
In an environment?
Answer:shelter, land, prey
Explanation:
PLEASE HELP ME!!!
3) Describe a eukaryotic cell. Your description should include where you would expect to
find these types of cells.
4)Describe a prokaryotic cell. Your description should include where you would expect to
find these types of cells.
3)Eukaryotic cells have membrane-bound organelles. They have a nucleus. They are usually found in animals and plants. In all multicellular organisms and some unicellular(amoeba)
4)Prokaryotic cells don't have a nucleus. They don't contain membrane-bound organelles they only contain ribosomes.They are much smaller. Bacteria are prokaryotes.
what occurs in a chemical reaction
Answer:
options on. D is write answer
5 tips to improve your critical thinking - Samantha Agoos
Watch the Video and make a summary
Ps: They don't let me paste the link lookup what it says above
Answer:
that one is hard because we did not see the vidoe
Explanation:
Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond
Answer:
A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.
Explanation:
Answer:
saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length
hope it helps
Explanation:
Tay-Sachs disease is a rare inherited disorder that progressively destroys nerve cells
in the brain and spinal cord. The allele for having Tay-Sachs is recessive written as t
and the functional allele is written as T. If two heterozygous parents have four
children, how many of the offspring will most likely inherit and develop Tay-Sachs
disease?
Answer:
B and C
Explanation:
I just took the test and it was right
1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False
Answer:
False.
Explanation:
Peer review provide others scientist in the field to assess a scientist's investigations and results.
Peer Review:
It is the reviewing or evolution of the work by many professionals and experts in the field.
For example- A scienfic manuscript is send to the many scientist for evolution before publication.
This peer review is unbiased because the reviewer does not know the name or other information about writter.
To know more about Peer Review:
https://brainly.com/question/10853815
How does soil erosion affect streams and rivers?
Explanation:
The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.
6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia
Answer:
Desert mole excretes concentrated urine with urea.
Marine fish excretes urine with uric acid.
Tilapia excretes dilute urine with amino acids.
Explanation:
The nitrogenous wastes that are excreted by the following organisms are as follows:
Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids. What is Nitrogenous waste?Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.
Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.
While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.
Therefore, it is well described above.
To learn more about Nitrogenous waste, refer to the link:
https://brainly.com/question/9517408
#SPJ2
Which of the following is an example of how a species may change over time?
A.
Bacteria become resistant to antibiotics.
B.
Dog fur becomes thicker in the winter.
C.
Turtles become male or female based on incubation temperature.
D.
Humans become immune to a certain illness after vaccination.
Answer: possibly A
Explanation: B an C are not it because they are more like mutations. D humans don’t always become immune.
According to Chargaff's rule of base pairing, which of the following is true about DNA?
O A=G and C=T
O A=T and C=G
O A=T=G=C
O A=C and G=T
Answer:
a = t and c = g
Explanation:
just took the test, hope this helps <3
brainliest pls? :)
The Char gaff rule is all about the number of adenine is equal to the number of thymine and with that the number of cytosine is equal to the number of guanine. The correct answer is option B.
What are the types of bonds that are present in between these nitrogenous bases ?The kind of bonds that are present in these nitrogenous bases are hydrogen bonds. A binds with T with two hydrogen bonds and C binds with G through 3 hydrogen bonds.
It is all about that the number of purines is equal to the number of pyrimidines. The number of adenine molecule are present totally in equivalence to the number of thymine molecules.
The number of guanine molecules are present in the molecule of DNA are totally in numbers to the cytosine. In place of thymine uracil is present which is present in RNA.
Learn more about DNA at :
https://brainly.com/question/14315652
#SPJ2
centricles play specific roles during the division of
Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them
Explanation:
someone pleaseee help me with this !!
This stuff annoying!!!!!!!!!!!!!!!!!!!!
wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink
what is a cell membrane?
Answer:
The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.
Explanation:
Answer:
Short. The semipermeable membrane surrounding the cytoplasm of a cell.
Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.
Explanation:
4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases
Answer:
The answer is A
Explanation:
am 100% sure
describe and explain how the rate of photosynthesis is affected by light intensity