3. DNA Replication has many key players! These are just a few of the major key player enzymes. In your own words,
describe each of their functions in DNA replication.
Helicase:
DNA Polymerase:
Primase:
Ligase:
Select Your Character
180
Drimas
Ligase

3. DNA Replication Has Many Key Players! These Are Just A Few Of The Major Key Player Enzymes. In Your

Answers

Answer 1

The functions of the few major key player enzymes in DNA replication include the following:

Helicase - They unwind the double stranded DNA to allow each strand to be copied.DNA Polymerase - It catalyzes the synthesis of double-stranded DNA molecule being copied into two identical DNA molecules.Primase - They are responsible for assembling on each template strand a short RNA primer that is extended with deoxynucleotides by the replicative DNA polymerase.Ligase -  They catalyze the joining of DNA strands.

What is DNA?

This is known as Deoxyribonucleic acid and carries genetic instructions in all living things.

Its synthesis is catalyzed by enzymes such as those listed above with their appropriate functions.

Read more about DNA here https://brainly.com/question/16099437


Related Questions

Can someone PLease help me with these questions?!

Answers

Answer:

I can't read it. It is too small

Explanation:

It is too small for me to read

Evaluate the role of media in addressing substance abuse with special reference to the following . 1television 2.social media platforms​

Answers

Social media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

What is social media?

Social media are online platforms that allows the user to create, write or display content and share with viewers and it also helps to access information and participate in many social networking.

Socal media campaigns have been done on television programs and other social media platforms to prevent the illicit use of drug by young and old people. This is because most young people visit the online platforms more and awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Therefore, media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Learn more on social media here,

https://brainly.com/question/3653791

Which would have a bigger effect on an organism, an error during transcription or a missense mutation? Explain in one or two sentences. (

Answers

How does a missense mutation affect the function of a protein?

A missense mutation will change the amino acid sequence. This may alter the function of the protein, usually negatively, but sometimes positively. This later case may be favored by evolution, as the change is heritable.

The Earth’s rotation is the only thing that impacts wind

Answers

Answer:

false

Explanation:

While the Earth's rotation does play a role, it is a somewhat indirect one. The primary factor that affects the formation of winds is differences in atmospheric pressure. As is true throughout nature, any fluid will try to move from a region of high pressure to a region of low pressure.

Answer:

False

Explanation:

This is false because the earth goes one way but the wind can go all kinds of ways

Look at the tropical grassland ecosystem.

Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.
Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.

There are more zebra than the carrying capacity of the pictured ecosystem. This represents a

climax community
biological surplus
peak phenomenon
sigmoid phenomenon

Answers

Answer:

It is B Biological Surplus

Explanation:

Biological Surplus means that a species population has grown too big, above carrying capacity

Why is over farming a threat to the health of humans?

A.
It decreases the use of fertilizer.

B.
It increases the production of food.

C.
It adds too many new nutrients to the soil.

D.
It removes too many nutrients from the soil.

Answers

Answer:

it removes too many nutrients from the soil.

Explanation:

Explanation:

it can increas the health risk

11
12
13
14
15
16
17
18
19
20
Air pollution affects everyone equally.
Please select the best answer from the choices provided
OT
OF

Answers

Answer:

16

Explanation:

Air pollution affects everyone equally is true statement.

What is Air pollution?

When pollutants are released into the atmosphere, they endanger both human health and the health of the entire planet. The World Health Organization (WHO) estimates that air pollution causes close to seven million deaths worldwide each year.

Currently, nine out of ten people breathe air that contains more contaminants than the WHO's recommended levels, with those in low- and middle-income nations suffering the most.

The 1970-established Clean Air Act gives the U.S. Environmental Protection Agency (EPA) the power to protect public health by controlling the emissions of certain dangerous air pollutants.

Therefore, Air pollution affects everyone equally is true statement.

To learn more about Air pollution, refer to the link:

https://brainly.com/question/18951513

#SPJ7

What are the impacts of genomic era on microbial phylogeny systematics​

Answers

provide a platform for current research on archaea, bacteria, microbial eukaryotes and viruses.

What is salinity and how does it change?.

Answers

A balance between water withdrawn by evaporation and freshwater added by rivers and rain controls salinity. The Mediterranean Sea in Europe has a salinity of 38 parts per million or more. It's nearly cut off from the main ocean, and there's more evaporation than rain or additional freshwater from rivers.

Salinity is controlled by a balance between water removed by evaporation and freshwater added by rivers and rain. changes in evaporation and rainfall, ocean currents, melting ice, and freshwater influx from rivers or streams can influence patterns of sea surface salinity, making some regions saltier and other regions fresher over time.

What is the great pacific trash gyre?

Answers

Answer:

The Great Pacific garbage patch (also Pacific trash vortex) is a garbage patch, a gyre of marine debris particles, in the central North Pacific Ocean. It is located roughly from 135°W to 155°W and 35°N to 42°N.

How have hominid skulls changed over time? What are some of the reasons for those
changes?

Answers

Answer:

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Explanation:

Give brainlist me please

Skull and face changes define modern humans - Harvard Gazette

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Different________show very different characteristics or variations, however you can also have_______within the same species.
A. Evolutionary animals, major differences
B. Species, variation
C. Animals, subspecies
D. Evolutionary animals, subspecies

Answers

I think B makes the most sense but I’m not too sure

VIDA chart for biology

Answers

Answer:

Yes you are right I didn't get the question too.

Which of these is a benefit of fish farming?
A. It poses a risk of disease for wild stocks.
B. It depletes fish populations.
C. It eases the demand on commercial fisheries.
D. It pollutes natural bodies of water.

Answers

Answer:

C

Explanation:

It's pretty simple really, just find the Benefit. Pollution is definitely a harmful effect, disease is also not a benefit, and depletion of fish population is bad, so easing demand on commercial fisheries is the answer

Which object measures atmospheric pressure?
a ballast tank
a barometer
a thermometer

Answers

Answer:

A barometer

Explanation:

It is commonly used to measure atmospheric pressure

So basically how do i ask my best friend out?

Answers

Answer:

Explain

well just do it i belive in you dont try to act all diffrent or cool that makes people not like u just be yourself

Human Use of Land
Journal Activity Active
Prompt
How has human land use impacted the environment?
Read More >>

Answers

Decreased water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

How human impacted the environment?

Humans impact the environment in many ways such as overpopulation, pollution, burning fossil fuels, and deforestation. Human activities triggered climate change, soil erosion, poor air quality, and undrinkable water.

So we can conclude that reduction of water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

Learn more about environment here: https://brainly.com/question/17413226

Which is NOT an example of leaves humans commonly eat?

Spinach
Zucchini
Kale
Field greens

Answers

zucchini is an example of leaves that humans don’t commonly eat.

Zucchini is a squash not a leaf.

Answer:

zucchini

Explanation:

At each link of the food web, approximately_________
percent of the energy is passed on to the consumer and
approximately_________
percent of the energy is lost as
heat.

Answers

Approximately 10 percent of the energy is passed on to the consumer and approximately 90 percent of the energy is lost as heat.

What is a Food web?

This refers to an interconnecting diagram that shows the overall food relationships between organisms in a particular environment.

90 percent of energy is usually lost as heat thereby allowing for the transfer of only 10 percent of energy to the consumers.

Read more about Food web here https://brainly.com/question/2179

What is black soil best for?
O constructing buildings
O having a wildlife environment
O having a desert environment
O farming land

Answers

Answer:

I believe the answer is farming

Answer:

having a wildlife environment

Explanation:

I took the test and this was the correct answer so your welcome

Examine the words and/or phrases below and determine the relationship among the majority of words/phrases. Choose the option that does not fit the pattern.

A. ash
B. dissolved gases
C. silica content
D. temperature

Answers

The only word among the available words that do not fit the pattern would be temperature.

Words and relationship

Ash, dissolved gases, and silica content are similar in the way that all of them are made up of matter.

Matter refers to any substance with weight and is able to occupy space. Ash is made from solid particles. dissolved gases are gases, and silica contents are also from solids.

Temperature, on the other hand, is a scalar quantity. It is not something that can be held or seen. It has no weight and neither does it occupy space.

More on matter can be found here: https://brainly.com/question/4513444

Name the five carbon sugar in a DNA neucleotide

Answers

deoxyribose is the 5carbon sugar found in DNA nucleotides

Which compounds are not soluble in water?

Answers

answer :

All salts of : carbonate, CO3 2- phosphate , PO4 3- oxalate, C2O4 2- chromate, CrO4 2-sulfide, S 2- most metal hydroxides and oxides (OH-)

Exceptions :

Salts of NH4 +, and the alkali metal cations

Answer:

All salts of : carbonate - phosphate - oxalate, chromate,- most metal hydroxides and oxides

Explanation:

the autonomic nervous system controls
A. tying your shoes
B. Heart Rate
C. chewing a bite of food
D. using a fork

Answers

The answer will be :

B. Heart Rate

the answer is B heart rate

Natural gas drilling locations are determined by
a random drilling
b. seismic surveys
C. natural gas dogs
d satellite surveys

Answers

Answer:

The answer is b. seismic surveys.

Answer:

B - SEISMIC SURVEYS

Explanation:

Describe the different internal and external factors that affect human health.

Answers

Answer: Biology, psychology, emotions, spirit, energy, lifestyle, culture, economic and political influences, social interactions in family, work, living area and the possibilities to expresses oneself and live full life with a sense of well-being have influence on people appearances.

Explanation:

What changes occur in the atmosphere as you go higher?.

Answers

Answer:

Air pressure drops, and temperatures get colder.

Explanation:

Hope this helps!!

At the molecular level, how do scientists know a new species has arisen?

Answers

Answer:

DNA sequencing has brought us the genetic species concept. In this model, species are defined by genetic isolation rather than reproductive isolation. Species may be more or less identical morphologically, but differences in DNA determine whether or not a population is a new species.

Explanation:

? :-)

Which type of rock would most likely be found near the landform shown in the picture? ​

Answers

Answer:

Igneous rock because it forms when hot molten rock (lava) crystallizes and solidifies .

Explanation:

Have a Nice day!!  :D

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Answers

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Answer:

C

Explanation:

Other Questions
The priest stared down at his scuffed brown loafers and the worn hem of his cassock. "for a christian burial it was necessary." his voice was distant, and leon thought that his blue eyes looked tired. "it's o.k., father, we just want him to have plenty of water." the priest sank down into the green chair and picked up a glossy missionary magazine. he turned the colored pages full of lepers and pagans without looking at them. "you know i can't do that, leon. there should have been the last rites and a funeral mass at the very least." based on this excerpt, what can be inferred about father pauls feelings? he secretly feels frustrated that leon and the pueblo people hold on to their traditional beliefs. he hopes to convince the pueblo people to convert from their traditional beliefs to christianity. he is upset because he is unable to stand up to leons demands and manipulations. he is discouraged because leon does not view the holy water as a holy symbol. Ayuda porfavor!! E estado intentando y no lo puedo resolverCURSO: MATEMTICAS FINANCIERAS How to transfer polygon from eth to polygon in ledger live Select all expressions equivalent to532202021245551.435.43 How do I do this question folks? . Which object has a constant speed?a bicycle coming to a stopa racecar starting a racea ball falling off a tablea car traveling the speed limit Sandy is designing a circular garden as shown in this image. Her plan is to fill the rectangular region with hyacinths. She will need 78 square feet of space per hyacinth bulb. The hyacinth bulbs are sold in packages of 8.What is the minimum number of packages Sandy must purchase to complete her plan?Select from the drop-down menu to correctly complete the statement.Sandy must purchase a minimum of _________ packages of hyacinth bulbs to complete her plan.options are, 5,6,7,8 the florin is a type of ___ used during international trade, that was established by the florentines.A. medicine B. wineC. currency When Mexico suffered from capital flight in 1994 Read the description of interphase at the bottom of the gizmo. What happens to the cell at the beginning of interphase? Which of the following is a way that climate affects soil formation?A) decrease in organic materialB) increase in chemical weatheringC) decrease in topsoil on a steep slopeD) decrease in parent material Write any two necessary condition for collinearity. I need to solve 5 :( I will give 500 points! What is the composition of Milk? CAN SOMEONE GIVE ME A RIGHT ANGLE TRIG WORD PROBLEM JUST MAKE IT UP PLS ILL GIVE BRAINLIEST What were the reasons for European migration to America? P: Using your prior knowledge how would you find the area of a rectangle ? ( 15 points plus brainliest!! )United States involvement in Cuban independence included all of the following except:A) anti-Spanish propagandaB) Spain's willingness to negotiateC) the damage to American business investmentsD) the explosion of the MaineE) the slandering of McKinley Describe how to express the rate of a chemical reaction In terms of risk or number of people helped does this document provide evidence of a great achievement