-17=x-15 what does x equal?

Answers

Answer 1

Answer:

-17=x-15 +15

-2=x

Step-by-step explanation:

prove me wrong

Answer 2

-17 = x - 15

Move -15 over to -17, it becomes a positive.

15 - 17 = x

15 - 17 = -2

x = -2


Related Questions

SOMEONE PLEASE HELP MEEE!!!!!!!!!!!

Answers

Answer:

81.6814 ft

Step-by-step explanation:

Select the correct answer.
The function fx) = 2x + 3x + 5, when evaluated, gives a value of 19. What is the function's input value?
OA 1
OB-1
О с 2
OD. -2
OE-3

Answers

It’s C but I’m not entirely sure

The input value that gives an output of 19 is not listed in the answer choices. None of the options are correct.

What are the factors?

A number or algebraic expression that evenly divides another number or expression—i.e., leaves no remainder—is referred to as a factor.

Here,
We can start by setting up the equation:

2x² + 3x + 5 = 19

Subtracting 19 from both sides:

2x² + 3x - 14 = 0

(2x - 7)(x + 2) = 0

Using the zero product property, we can solve for x:

2x - 7 = 0 or x + 2 = 0

2x = 7 or x = -2

x = 7/2 or x = -2

Therefore, the input value could be either 7/2 or -2.

The answer choices do not include 7/2, but we can check both input values to see which one gives an output of 19:

f(7/2) = 2(7/2)^²+ 3(7/2) + 5 = 19.25

f(-2) = 2(-2)² + 3(-2) + 5 = 3

Thus, the input value that gives an output of 19 is not listed in the answer choices.

Learn more about Factors here:

https://brainly.com/question/24182713

#SPJ7

Simplify. 74 Your answer?
i need help asap!​

Answers

Answer:

Simplify 74? Did you forget something?

Step-by-step explanation:

It isn't possible to simplify a whole number...

Write the number seven hundred and ninety four in figures

Answers

Answer: 56 785 is written as fifty six thousand, seven hundred and eight five. The number 406 090 is written as four hundred and six thousand and ninety. Numbers with seven, eight or nine digits, are millions. 46 758 442 is forty six million, seven hundred and fifty eight thousand, four hundred and forty two.

Step-by-step explanation:

The number would be 794 in figure form which represents seven hundred and ninety-four.

What is the number system?

A number system is defined as a way to represent numbers on the number line using a set of symbols and approaches. These symbols, which are known as digits, are numbered 0 through 9. Based on the basic value of its digits, different types of number systems exist.

Calculating the number of quantities for an object or the Number of things left in the container are only two examples of the types of mathematical operations that utilize the Number System.

We have to write the number seven hundred and ninety-four in figures

As per the given statement, the expression would be:

⇒ 700 + 94

⇒ 794

Therefore, the number seven hundred and ninety-four in figure form would be 794.

Learn more about the number system here:

https://brainly.com/question/21751836

#SPJ5

Please help, I’m literally crying

Answers

Answer:

1 because 91-18=1

Step-by-step explanation:

Rachel is planning to run an average of 6.4 miles over three consecutive days. On the first
day, she ran 6.6 miles, and on the second day, she ran 6.5 miles. What is the maximum
number of miles Rachel can run on the third day without going over the planned average of
6.4 miles per day?

Answers

6.6+6.4= 13.1

6.4 x 3 = 19.2

19.2- 13.1 = 6.1 miles

The maximum  number of miles Rachel can run on the third day without going over the planned average of  6.4 miles per day is 6.1 miles.

Maximum  number of miles:

Let x represent the maximum  number of miles

Formulate

6.6+6.5+x÷3=6.4

Hence:

6.6+6.5=6.4×3

13.1+x=19.2

x=19.2-13.1

x=6.1 miles

Inconclusion the maximum  number of miles Rachel can run on the third day without going over the planned average of  6.4 miles per day is 6.1 miles.

Learn more about distance here:https://brainly.com/question/4931057

I need this answer ASAP

Answers

Answer:

i think the area is 60 i added it up

What is an equation in slope-intercept form for the line that passes through the points (1, -3) and (3, 1)?

A. y= 3x + 1
B. y= x-3
C. y= 2x + 5
D. y= 2x-5


° ♡ ₒ ♡ °
thank you!

Answers

D.y=2x-5


I think, i hope this helps
The slope intercept form is y= 2x-5

Can you please mark BRAINLEST

100 points!

Romantic writers rejected the logical style of writers from the age of reason and instead focused on individual experiences, thoughts, and emotions. Romantic literature used lofty, expressive language to highlight a particular mood and message. What do you think these techniques offered to romantic writers that previous styles did not? Consider the romantic literature you have read. Do you think these techniques and styles were effective for the themes and subjects being addressed? Why or why not?

Answers

Answer:

Step-by-step explanation:

Romantic writers have the advantage of writing what they feel not just what they made up. Romantic writers can make a book sad, scary, and happy. Whereas fictional books almost always end up perfect for the main character. I do think that the techniques and styles were effective for the themes and subjects being addressed because they flow into the subject. Using an absolute sob story for a romantic book could be passed off as a hit if you use the right techniques. So, yes. I do think that the techniques and styles were effective for the themes and subjects being addressed.

You spent $34 for 8.5 gallons of gasoline. At
the same price per gallon, how many gallons
could you buy for $51?

Answers

12.75 gallons of gasoline
Your answer is going 12.75 gallons

Select the reason why these triangles are
similar. If they are not, select "Not similar".
A. AA
B. SAS
C. SSS
D. Not similar

Answers

Answer:

The reason why these triangles are similar is;

A. AA

Step-by-step explanation:

A two column proof can be presented using the drawing of the question diagram created with Microsoft Visio as follows;

Statement      [tex]{}[/tex]                  Reason

[tex]\overline {AB}[/tex] ║ [tex]\overline {DE}[/tex]   [tex]{}[/tex]                      Given

∠ACB ≅ ∠DCE       [tex]{}[/tex]         Vertically opposite angles

∠BAC ≅ ∠DEC       [tex]{}[/tex]         Alternate interior angles theorem

∠ABC ≅ ∠CED       [tex]{}[/tex]         Alternate interior angles theorem

ΔABC ~ ΔCDE        [tex]{}[/tex]         By Angle-Angle (AA) similarity postulate

Therefore, the correct option is AA.

PLEASE HELP .
What is the length of side BC to one decimal place?

Answers

Answer: 9.0

Step-by-step explanation:

Solve the equation: 3(x + 2) = 40.2 *
please help

Answers

Answer: x=11.4

Step-by-step explanation:  3(x+2)=40.2

(3)(x)+(3)(2)=40.2

3x+6=40.2

3x+6−6=40.2−6

3x=34.2

3x /3 = 34.2 /3

x=11.4

5x – 7y = 245?
What’s the y intercept

Answers

Answer:

(49,0)(0,-35)

y intercept (0,-35)

x intercept (49,0)

Step-by-step explanation:

Can a triangle can have sides with lengths 2.7, 3.5, and 9.8.

Answers

Answer: No

Step-by-step explanation:

2.7 + 3.5 is not greater than 9.8.

Answer:

no It cant

Step-by-step explanation:

2.7 + 3.5 is not greater than 9.8.

Plz help it due In 20 mins

Answers

Answer:

Slope of line A= -1/3

B=-1

C= -5/4

Step-by-step explanation:

Use: slope m= y-y1/ x-x1

Find the GCF of 8a^3b^5c^2 and 12a^2b^3c^2
*Please show your steps to the equation*

Answers

Ans = 4abc^2
Greatest common factor of 8 and 12 is 4
A^3 and a^2 = a
B^5 and b^3 = b
C^2 and c^2= c^2

At Yankee Candle, four large candles and three small candles sell for $34. For
two large candles and one small candle, the cost is $16. Choose a system of
equations to find the cost of large and small candles.

Answers

Answer:

the answer is D

Step-by-step explanation:

{4x+3y=34

{2x+y=16

An equation is a mathematical statement that is made up of two expressions connected by an equal sign.

The system of equations to find the cost of large and small candles are,

4x + 3y = 34

2x + y = 16

Option D is the correct answer.

What is an equation?

An equation is a mathematical statement that is made up of two expressions connected by an equal sign.

Example: 2x + 4 - 8 is an equation.

We have,

At Yankee Candle, four large candles and three small candles sell for $34. For two large candles and one small candle, the cost is $16.

Large candles = x

Small candles = y

Now,

4x + 3y = 34

2x + y = 16

Thus,

The system of equations to find the cost of large and small candles are,

4x + 3y = 34

2x + y = 16

Option D is the correct answer.

Learn more about equations here:

https://brainly.com/question/17194269

#SPJ2

HELP ILL MARK YOU BRAINLIST write in y=mx+b form HELP ILL MARK YOU BRAINLIST write in y=mx+b form

Answers

4 because 12 deveined by 3 is four, so four for every one point moved up

PLEASE HELP ME
Will mark brainliest ​

Answers

Answer: Its the last one trust me

Step-by-step explanation:

Which table represents the function y = 4x - 3?

Answers

Answer:

B

Step-by-step explanation:

Answer:

Second table (B)

Input: 0, 1, 2

Output: -3, 1, 5

Explanation:

Given the 2D linear equation y = 4x - 3,

y must represent the output because it is the dependent variable, so x must represent the input because it is a independent variable.

123% of what is 111?

this is one of the reasons I hate math

Answers

Answer:

90.244

Step-by-step explanation:

111 ÷ 1.23 = 90.244

I need help with this... plz

Answers

Answer: 11,600

you multiply 58,000 by 0.8 and you’d get 46,400. then you would subtract that number by 58,000 to get the answer of 11,600.

x x=ly y=2x-2
you need use solving systems substitute​

Answers

Answer:

3

Step-by-step explanation:

If you substitute the values x = 0 and y = −5 into the second equation, you get a false statement: 2(−5) − 10 = 2(0). To solve this system, try rewriting the first equation as x = 2y − 8. Then substitute 2y − 8 in for x in the second equation, and solve for y. The correct answer is x = −2, y = 3.

Not what I really think it might be, but I hope it helped you!

Is the following sequence arithmetic, geometric, or neither?
-6, -2, 2, 6, 10, ...

Answers

Answer:

gay lol lol

Step-by-step explanation:

wesd yessir gay mf

Henry rolls a fair dice 42 times. How many times would Henry expect to roll a number greater than 5?​

Answers

Answer:

7 times

Step-by-step explanation:

There is one number greater than 5 on a dice - that is the number 6.

So probability of throwing a six = 1/6.

So it is 42 * 1/6.

What is greater than 4.026

Answers

Answer/Step-by-step explanation:

The number 5 is greater than 4.026

Hope this helps!

Answer:

4.027

Step-by-step explanation:

Just add a number to the problem

3x + 2x +9 = 10-14
Solve for x

Answers

Answer:

-2.6

Step-by-step explanation:

3x+2x+9=10-14

5x+9=10-14

5x+9=-4

5x=-4-9

5x=-13

x=-13/5

x=-2.6

HELP ME PLEASE!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

For Which expression is of trinomial degree 1?
6+X-y
For what is the value of M
5

Heather works 40 hours a week and she earns $11.50 per hour. When Heather works over 40 hours, her pay is 1.5 times her hourly pay. How much does Heather earn if she works 46 hours in one week?

Answers

Answer:

563.5

Step-by-step explanation:

it's pretty easy ngl

Answer:

563.5

Step-by-step explanation:

Other Questions
2 examples of peer pressure in The Sneetches How do the dwarfs react to Snow White's appearance in their home?A: The dwarfs demand that Snow White leave the cottage and return to the woods.B: The dwarfs are relaxed because they are used to visitors.C: The dwarfs admire her beauty and leave her undisturbed.D: The dwarfs are angry when they realize that their beds have been slept in. ILL GIVE BRAINLYIn this political cartoon, created by Benjamin Franklin as the French and Indian War began, what do the parts of the snake represent?A. colonies bordering Spanish territoryB. French colonies in North AmericaC. The Southern ColoniesD. English colonies in North America In what ways was the Hundred Years War a new kind of war A: it was caught between nations that were becoming unified states B: it was fought between two religions. Christianity and Islam. Rather between different countries. Find the value: 3/2 5/8 (write your answer as a fraction AND as a decimal number) decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA what is 0.41891891891892 to two significant figures? I. Fill in the blanks below with the appropriate vocabulary in Spanish. Think about what you have learned so far.1. Es necesario estudiar mucho. = que estudiar mucho.2. Lo . No puedo ir al cine contigo.3. No voy a tomar un taxi. Voy a tomar (the bus).4. Voy a tomar el en la playa.5. Los domingos, mi familia y yo vamos a la .6. Necesito dinero. Voy al .7. Me encanta la msica! Me ir al concierto contigo.8. El metro = 9. Me gusta novelas.10. A mi hermano le gusta cartas.II. Answer the following questions with complete sentences in Spanish. When there are clues provided, use them in your answer.1. Adnde vas para comprar libros?2. Adnde van Uds. para ver una pelcula?3. Qu tienes que hacer hoy? (read a novel)4. Qu vas a hacer esta noche? (go to the museum)5. Tell someone who invites you somewhere that you are sorry but you have another engagement.6. Tienes que estudiar mucho?7. Van Uds. al correo para mandar una carta?8. Tell a friend that you would love to go to a club to dance.9. A qu hora vas a ir a la biblioteca para estudiar? (6:30)10. Por qu vas a la panadera? (I have to buy bread.)thank you! solve for z: -21 = z - (-6 - 2z) What evidence show that Judaism unified the Jewish A history question ????help Which graph represents all of the solutions of A delivery truck drove 52 miles per hour. It took 4 hours to travel between two towns. What is the distance between the two towns? Use the equation dert, where d is distance, r is rate, and t is time. The distance between the two towns is miles. Which scales are equivalent to 1 inch to 1 foot? Select all that apply. Group of answer choices 1 to 12 (1/12) to 1 100 to 0.12 5 to 60 36 to 3 9 to 108 PLEASE HURRY IM ON THE FINAL BEING TIMEDThe group of Muslims that believed in electing a new leader that would strictly follow Muhammads example were called __________.A.ShiitesB.SunnisC.AlisD.CaliphsPlease select the best answer from the choices providedABCD Energy that depends upon object mass and object height. How did African Americans take advantage of their new political rights, and what affect did this have on American politics Which of the following is not a function?a. (1,1),(2,2), (3,3), (4,4)b. (2,3), (2,4), (3,3), (3,4)c (2,4),(4,8).(10,12). (4,10)d. (2,4), (3,4), (5,4), (6,4) R IN Complete the following statement. The quotient of 5 = A is equal to the quotient of A +5. . B C D E O== 0 1 NEXT QUESTION O ASK FOR HELP Can anyone help me with these? It's a yes or no question...