10) A boat travels 30 km up a river in the same time it takes to travel 50 km down the same river. If the current of water is 5km/h. What is the speed of the boat in still water? Be sure to show your work to earn full credit. Here's a chart to get you started: Travel Rate Time Distance​

Answers

Answer 1

As a result, when a boat goes 30 km up a river in the same amount of time, its speed in still water is 20 km/h.

what is equation ?

The numeral is said to be in this simplest form when divided into its smallest equivalent fraction. How to do to find the most basic form. Find common factors in the denominator and numerators. Verify a fractional integer to verify if it passes as a prime number. A statement having two collinear and an equally sign in the middle is called an equation in mathematics. The general form of any equation contains the degrees of all the variables in descending order. The normal form of a linear function is an x + b = 0. The general form of a linear equation with two variables is an x + b y + c = 0. (or something similar). Equations can be categorised as identities or conditional equations. An identity holds true regardless of the value given to the variables.

given

Let the boat's speed in calm water be x km/h.

Boat speed downstream is equal to x plus 5.

Upstream boat speed is equal to x - 5

Distance x time speed

Time is therefore determined by speed and distance.

Boat travel time is equal to 30/km upstream (x – 5)

50/(x + 5) is the time it takes a boat to travel 50 kilometres downstream.

Since the boat takes the same amount of time in both scenarios, 30 (x + 5) = 50 (x -5), 30 x +150 = 50 (x -250), 20 (x = 400), and 20 (x = 20).

As a result, when a boat goes 30 km up a river in the same amount of time, its speed in still water is 20 km/h.

To know more about equation visit:

https://brainly.com/question/649785

#SPJ1


Related Questions

Jacob has a smart phone data plan that costs $25 per month that includes 5 GB of data, but will charge an extra $20 per GB over the included amount. How much would Jacob have to pay in a month where he used 4 GB over the limit? How much would Jacob have to pay in a month where he used went over by � x GB?

Answers

The amount Jacob has to pay in a month where he used x GB over the limit is  y=25+20x.

What is an equation?

In mathematics, an equation is a formula that expresses the equality of two expressions, by connecting them with the equals sign =.

Given that, Jacob has a smart phone data plan that costs $25 per month that includes 5 GB of data, but will charge an extra $20 per GB over the included amount.

Amount Jacob has to pay in a month where he used 4 GB over the limit is

25+4×20

= $105

Amount Jacob has to pay in a month where he used x GB over the limit is

y=25+20x

Where, y is total amount of money

Hence, the amount Jacob has to pay in a month where he used x GB over the limit is  y=25+20x.

To learn more about an equation visit:

https://brainly.com/question/14686792.

#SPJ1

Answer:

Step-by-step explanation:

I don’t know just 5 point

List the elements of each of the following sample spaces: (a) the set of integers between 1 and 50 divisible by 8. (b) the set S = (x1x2 + 4x - 5 -0. (c) the set of outcomes when a coin is tossed until a tail or three heads appear. (d) the set S = {x|2x - 4 20 and x < 1)

Answers

a)The set of integers between 1 and 50, divisible by 8 are given as.

S={ 8,16,24,32,40,48}

b ) Hence, the set {-5,1}

c) The list of set of outcomes when a coin is tossed until a tail or three heads appear will be.

S={T,HT,HHT,HHH}

d) S={Europe, Asia, Australia, North America, South America, Africa, Antarctica.}

a) We have to find a list of integers between 1 and 50, divisible by 8.

Keep in mind that the S is the event that represents the sample space. The set of integers between 1 and 50, divisible by 8 are given as.

S={ 8,16,24,32,40,48}

b)  We need to list the set S= {[tex]x| x^2+4x-5=0}[/tex]}

[tex]x^2+4x-5=0\\\\x^2+5x-x-5=0\\x(x+5)-(x+5)==\\(x+5)(x-1)=0\\\\x=-5 , x=1[/tex]

Hence, the set {-5,1}

c) c) We have to find a list of the set of outcomes when a coin is tossed until a tail or three heads appear.

Let T denote the event that tail appeared.

Let H denote the event that head appeared.

The list of set of outcomes when a coin is tossed until a tail or three heads appear will be.

S={T,HT,HHT,HHH}

d) We need to list the set

S={x ∣ x is a continent}.

There are 7 continents:

S={Europe, Asia, Australia, North America, South America, Africa, Antarctica.}

learn more about Set,

https://brainly.com/question/8053622

#SPJ4

Two bicycle ramps each cover a horizontal distance of 8 feet. Once ramp has a 20° angle of elevation, and the other ramp has a 35° angle of elevation
How much taller is the second ramp than the first?

Answers

So below I’ve attached an image for the ramps.
We are given two ramps, both covering 8ft horizontally. One ramp has 20 degrees of elevation, another has 35 degrees.
Let’s separate the two ramps using x and y.
And let’s solve:
Because it’s a right triangle, we will be using sine, cosine, or tangent to find the missing side (vertical).
We will use tangent because tangent is opposite/adjacent. We have the adjacent side, and we need to find the opposite side.
So let’s solve the first one:
tan20degrees=x/8
x=2.9ft

And now the second:
tan35degrees=y/8
y=5.6ft

Now subtract the second by the first to find the difference in height:
5.6-2.9=2.7

The second ramp is 2.75ft taller than the first.

Hope this helped!

Find the value for the following determinant

Answers

Answer:

42

Step-by-step explanation:

determinant of matrix

= 5(2) - 8(-4)

= 10 - (-32)

= 10 + 32

= 42

Answer:

32

Step-by-step explanation:

the determinant of matrix

[tex]\left[\begin{array}{ccc}a&b\\c&d\\\end{array}\right][/tex] = ad - bc

then

[tex]\left[\begin{array}{ccc}5&-4\\8&2\\\end{array}\right][/tex]

= (5 × 2) - (- 4 × 8) = 10 - (- 32) = 10 + 32 = 42

a) Estimate the initial and final amounts of water contained in the pool.
The initial amount of water contained in the pool was __ thousands of gallons.

Answers

The required  initial and final amounts of water contained in the pool are 46 ans 26 gallons of water.

Explain about Graph?

A graph is made up of vertices, or points, and edges, or lines connecting those vertices. In addition to linked and disconnected graphs, weighted graphs, bipartite graphs, directed and uncorrected graphs, and simple graphs, there are many other forms of graphs.

According to question:

As graph says

The initial amount of water contained in the pool is

at t = 0

= 46 gallons of water

And at t = 5, is final amount of water in pool

= 26 gallon of water

Thus, there are 46 ans 26 gallons of water.

To know more about graph visit:

brainly.com/question/17267403

#SPJ1

Write this in exponential form
5^2 x 5^6

Answers

Since we are multiplying, we keep 5 constant. To figure out the exponent, you add the 2 and the 6. So, therefore the answer is 5^8

How do I do this problem I do not get it do I add when I found the volume of both

Answers

Answer:

206

Step-by-step explanation:

cube volume = 5*5*5 +3*3*3 = 125+81 = 206

Please answer this question for me

Answers

Using properties of triangles, Correct options are A,B and D. AE = EB, EG || AC and AC = 2 EG.

A triangle has three sides, three angles, and three vertices, which are its characteristics.

A triangle's total internal angles are always equal to 180 degrees. This is referred to as the triangle's angle sum property.

Any two triangle sides can add up to a length that is longer than the third side.

A triangle's total angles are always 180 degrees.

A triangle's outside angles are always a sum of 360 degrees.

The total of the parallel interior and exterior angles is additional.

From the given figure,

As E is the mid point of BA,

So, BE = EA

As it is clearly seen that EG is parallel to AC = EG||AC

Further,

As, EG is intersecting AB and BC at mid points,

⇒ AC = 2EG

To learn more about triangles from given link

https://brainly.com/question/27996834

#SPJ1

Given right triangle ABC, where side "c" is the hypotenuse, angle B measures 42 degrees, and side c measures 18 m, find the length of side b.

Answers

The length of side b of the given right angle triangle using law of sines is; b = 12.044 m

How to use the law of sines?

The law of sines states that when we divide side "a" by the sine of angle A, it is equal to side "b" divided by the sine of angle B, and also equal to side "c" divided by the sine of angle C

Thus;

a/sin A = b/sin B = c/sinC

The parameters are;

B = 42°

c = 18m

Since c is the hypotenuse, it is the side that will be opposite the right angle and so;

C = 90°

Thus, using sine rule;

c/sinC = b/sin B

18/sin 90 = b/sin 42

b = (18 * sin 42)/1

b = 12.044 m

Read more about law of sines at; https://brainly.com/question/4372174

#SPJ1

Can someone help is for geometry

Answers

A truth table deconstructs a logic function by outlining all possible outcomes the function might achieve.

Explain about the truth table?

A truth table offers a way to map out the potential truth values in an expression and predict their results. The table has a row for each conceivable combination of truth values and a column for each variable in the expression. There is also a column that displays the results of each set of values.

For propositional logic formulations, this tool builds truth tables. There are numerous formats available for entering logical operators. As an illustration, the propositional formula p q r could be represented as p / q -> r, p and q => not r, or p && q ->!r. You can enter the connectives and as T and F.

P Q (Q ∧ P)

F F F

F T F

T F F

T T T

To learn more about truth table refer to:

brainly.com/question/18575348

#SPJ1

during the winter season, a prominent newspaper reporter is interested in writing a story about the lack of proper heating of apartment buildings in the city in which he lives. during a particularly frigid weekend, this reporter manages to interview almost everyone in his own apartment building. the reporter finds that everyone, including himself, is satisfied with the heating in the apartment building. identify the type of sampling used in this example. a) Cluster sampling b) Convenience sampling c) Voluntary response sampling d) Systematic sampling 1 e) Attempted census

Answers

The type of sampling used in this example is Convenience sampling.

Convenience sampling is a type of non-probability sampling in which the sample is selected based on the ease of access or availability of the subjects. The sample is selected based on the researcher's convenience, and it does not use a random selection process.

In this case, the reporter chose to interview people in his own apartment building because it was convenient for him and he had easy access to them.

The other options you listed are:

a) Cluster sampling, which is a form of probability sampling in which the sample is selected by first dividing the population into smaller groups or clusters, and then selecting a random sample of those clusters.

b) Voluntary response sampling, which is a type of non-probability sampling where individuals choose to participate in the study.

c) Systematic sampling, which is a form of probability sampling in which the sample is selected by choosing a random starting point and then selecting every nth subject from the population.

d) Attempted census, which is when the researcher tries to include all members of a population in the sample.

Therefore, The type of sampling used in this example is Convenience sampling.

To know more about convenience sampling refer to:

brainly.com/question/1413932

#SPJ4

The number N of locations of a popular coffeehouse chain is given in the table. (The numbers of locations as of October 1 are given.)Year 2004 2005 2006 2007 2008N 8,574 10,238 12,440 15,006 16,676a. Find the average rate of growth between each pair of years.2004 to 2006 _____ locations/ year2006 to 2007 _____ locations/ year2005 to 2006 _____ locations/ yearb. Estimate the instantaneous rate of growth in 2006 by taking the average of the last two rates of change in part (a).c. Estimate the instantaneous rate of growth in 2006 by measuring the slope of the tangent line through (2005, 10,238) and (2007, 15,006).d. Estimate the instantaneous rate of growth in 2007 by measuring the slope of the tangent line through (2006, 12,440) and (2008, 16,676).e. Compare the growth rates you obtained in part (c) and (d). What can you conclude?1. The rate of growth is increasing.2. The rate of growth is decreasing.3. The rate of growth is constant.4. There is not enough information.

Answers

a. To find the average rate of growth between each pair of years, we can use the formula: (end value - start value) / (end year - start year).

2004 to 2006: (12,440 - 8,574) / (2006 - 2004) = 3,866 / 2 = 1,933 locations/year

2006 to 2007: (15,006 - 12,440) / (2007 - 2006) = 2,566 / 1 = 2,566 locations/year

2005 to 2006: (12,440 - 10,238) / (2006 - 2005) = 2,202 / 1 = 2,202 locations/year

b. To estimate the instantaneous rate of growth in 2006, we can take the average of the last two rates of change from part (a).

(2,566 + 2,202) / 2 = 2,384 locations/year

c. To estimate the instantaneous rate of growth in 2006 by measuring the slope of the tangent line through (2005, 10,238) and (2007, 15,006), we can use the formula:

(15,006 - 10,238) / (2007 - 2005) = 4,768 / 2 = 2,384 locations/year

d. To estimate the instantaneous rate of growth in 2007 by measuring the slope of the tangent line through (2006, 12,440) and (2008, 16,676), we can use the formula:

(16,676 - 12,440) / (2008 - 2006) = 4,236 / 2 = 2,118 locations/year

e. Comparing the growth rates from part (c) and (d), we can see that the growth rate in 2007 is less than the growth rate in 2006. So we can conclude that 2. The rate of growth is decreasing.

To learn more about Growth Rates

Visit; brainly.com/question/14263843

#SPJ4

A caterer for a wedding reception wants to use a recipe for eggplant salad that recommends using 0.7 kg of eggplant for guests.​ However, in her​ area, eggplant is only sold by the pound. If 70 guests are​ expected, how many pounds of eggplant should the caterer​ purchase?

Answers

By performing a change of units, we will see that the caterer should purchase 107.8 lb

How many pounds of eggplant should the caterer​ purchase?

First, let's find how many kilograms are needed. We know that the recipe recomends using 0.7kg per person, and there are 70 guests, so an estimate of the mass needed is:

M = 70*0.7kg = 49 kg

Now weneedto do a change of units, we know that:

1 kg =  2.2 lb

Then we can rewrite:

49 kg = 49*(2.2 lb) = 107.8 lb

The caterer should purchase 107.8 pounds

Learn more about changes of units at:

https://brainly.com/question/141163

#SPJ1

5. a random sample of 500 subjects measured their systolic blood pressure, and if they were a smoker or not. the goal is to evaluate if average systolic blood pressure differs by smoking status. summary sample statistics on the dataset follow:

Answers

There is a difference in average systolic blood pressure between smokers and non-smokers.

To evaluate if average systolic blood pressure differs by smoking status, we need to calculate the mean systolic blood pressure for both smokers and non-smokers. We can calculate the mean systolic blood pressure for smokers by taking the sum of systolic blood pressure values for all smokers in the sample, divided by the number of smokers in the sample. This formula can be written as:

Mean Systolic Blood Pressure for Smokers = (Sum of Systolic Blood Pressure Values for all Smokers) / (Number of Smokers)

Similarly, we can calculate the mean systolic blood pressure for non-smokers by taking the sum of systolic blood pressure values for all non-smokers in the sample, divided by the number of non-smokers in the sample. This formula can be written as:

Mean Systolic Blood Pressure for Non-Smokers = (Sum of Systolic Blood Pressure Values for all Non-Smokers) / (Number of Non-Smokers)

Once we have calculated the mean systolic blood pressure for both smokers and non-smokers, we can compare the two means to evaluate if there is a difference in average systolic blood pressure between smokers and non-smokers.

Learn more about difference here:

https://brainly.com/question/29068415

#SPJ4

A triangle with a perimeter of 48 meters was created from a triangle with a perimeter of 3 meters using a scale factor. What is the scale factor?
A. 72:1
B. 16:1
C. 128:1
D. 144:1

Answers

I believe the answer is 16:1
Because 16 x 3 = 48

Good luck


As of summer 2020, Voyager 1 is about 13.8 billion miles from Earth. Express this distance in AU,
using scientific notation, with two significant figures.

Answers

Answer:

1.478 x 10^2 AU

Step-by-step explanation:

To convert this distance to astronomical units (AU), we can use the fact that 1 AU is approximately equal to 93 million miles.

So, 13.8 billion miles is approximately:

13.8 billion miles / 93 million miles/AU = 147.8 AU

In scientific notation, this distance would be written as: 1.478 x 10^2 AU

Need to know answer to question !

Answers

the fourth one. I know it is correct, you may look it up on the desmos graphing calculator if you have suspicion it is not.

fraction numerator dover denominator d x end fraction open square brackets in parentheses 4 x minus 7 close parentheses to the power of 4 open parentheses 7 x plus 8 close parentheses to the power of 5 close square brackets.

Answers

Differentiating the expression [tex]\frac{d}{dx} [(4x-7)^4(7x+8)^5 ][/tex] with respect to x will be [tex]16(4x-7)^3(7x+8)^5 + 35(4x-7)^4(7x+8)^4[/tex]

We are given with

[tex]\frac{d}{dx} [(4x-7)^4(7x+8)^5 ][/tex]

Here we will be using the chain rule. According to the chain rule, we will first have to solve the parentheses as a variable. Then we will have to solve the expression within the parenthesis

First, we will differentiate [tex](4x-7)^4[/tex] keeping [tex](7x+8)^5[/tex] constant. Here we will first assume [tex](4x-7)[/tex] as one variable and differentiate using the formula d/dx[x^n] then we will differentiate 4x - 7 to get just 4. They would be multiplied by one another

Hence we get

[tex]4 X4(4x-7)^3(7x+8)^5[/tex]

[tex]16(4x-7)^3(7x+8)^5[/tex]

Now, we will keep [tex](4x-7)^4[/tex] constant and differentiate [tex](7x+8)^5[/tex] and adding it up we get

[tex]16(4x-7)^3(7x+8)^5 + 5X7(4x-7)^4(7x+8)^4[/tex]

[tex]= 16(4x-7)^3(7x+8)^5 + 35(4x-7)^4(7x+8)^4[/tex]

To learn more about Differentiation visit

https://brainly.com/question/29338380

#SPJ4

Complete Question

[tex]\frac{d}{dx} [(4x-7)^4(7x+8)^5 ][/tex]

How do you factor this problem by grouping?
4x∧3-3x∧2-28x+21

Answers

Answer:

(x^2 - 7)(4x - 3)

Step-by-step explanation:

first, we split the expression by grouping the first two terms in parentheses and the last two terms in parentheses. this gives us:

[tex](4x^{3}-3x^{2})(-28x+21)[/tex]

next, we factor out the GCF of each group. this gives us:

[tex]x^{2}(4x-3)-7(4x-3)[/tex]

finally, all you have to do is take each factored-out term and put them together into a group/expression. the leftover expression from both groups is the same value, so you get:

[tex](x^{2}-7)(4x-3)[/tex]

hope this helped, good luck!

Part A Create the smallest cylinder possible with the tool, and record the values o cylinder by the given scale factors, and then record the resulting volumes ( cylinder. BI UX² X₂ 12pt Original Cylinder Radius (units) 2 Scale Factor (k) AV Radius Height (units) funite Height (units) A 6 Volume (V) 13 13 E Volume (cu. unit: 8 Vxk³. scaled cylinders are 2, 3, and 4​

Answers

The original cylinder has a radius of 2 units and a height of 13 units, and its volume is given by the formula: V = πr²h = π * 2² * 13 = 104π cubic units.

How you can create the smallest cylinder?

Original cylinder: The original cylinder has a radius of 2 units and a height of 13 units, and its volume is given by the formula: V = πr²h = π * 2² * 13 = 104π cubic units.

Scaled cylinder 1: The first scaled cylinder has a scale factor of 2, so its radius is 2 * 2 = 4 units and its height is 13 * 2 = 26 units. Its volume is given by: V = πr²h = π * 4² * 26 = 672π cubic units.

Scaled cylinder 2: The second scaled cylinder has a scale factor of 3, so its radius is 2 * 3 = 6 units and its height is 13 * 3 = 39 units. Its volume is given by: V = πr²h = π * 6² * 39 = 1764π cubic units.

Scaled cylinder 3: The third scaled cylinder has a scale factor of 4, so its radius is 2 * 4 = 8 units and its height is 13 * 4 = 52 units. Its volume is given by: V = πr²h = π * 8² * 52 = 3072π cubic units.

Learn more about cubic units in brainly.com/question/16323498

#SPJ1

Given that f(x) = x3, which equation describes the graph of function g?

Answers

The equation which represents the graph function is g ( x ) = f ( x - 3 ) + 3

What is Equation of Graph of Functions?

Graphs behave differently at various x-intercepts. Sometimes the graph will cross over the x-axis at an intercept. Other times the graph will touch the x-axis and bounce off.

Identify the even and odd multiplicities of the polynomial functions' zeros.

Using end behavior, turning points, intercepts, and the Intermediate Value Theorem, plot the graph of a polynomial function.

The graphs cross or are tangent to the x-axis at these x-values for zeros with even multiplicities. The graphs cross or intersect the x-axis at these x-values for zeros with odd multiplicities

Given data ,

Let the function be represented as A

Now , the value of A is

f ( x ) = x³   be equation (1)

Now , the graph of the function f ( x ) is plotted with the exponent value meeting closely at ( 0 , 0 )

And , the function which describes the function g ( x ) is given by

g ( x ) = f ( x - 3 ) + 3

Hence , the function is g ( x ) = f ( x - 3 ) + 3

To learn more about graph of functions click :

https://brainly.com/question/16957172

#SPJ2

What is the chance of exactly 1 of population members A , B, and C being in a sample of 100 , drawn randomly from a population of 100,000?

Answers

The chance of exactly one of population members A, B, and C being in a sample of 100, drawn randomly from a population of 100,000 is 0.0003%.

What is the chance of exactly 1 of population members A , B, and C being in a sample of 100 , drawn randomly from a population of 100,000?The probability of exactly one of population members A, B, and C being in a sample of 100, drawn randomly from a population of 100,000, is equal to the product of the probability of selecting each of the members and the probability of not selecting the other two members. Mathematically, this is expressed as: P(A, not B, not C) = (1/100,000) x (99,999/100,000) x (99,998/100,000) The probability of exactly one of population members A, B, and C being in a sample of 100, drawn randomly from a population of 100,000, is equal to 0.00299970 or approximately 0.003.This is an example of the binomial probability formula which is used to calculate the chance of a certain number of successes in a given number of trials. In this example, the population members A, B, and C represent the successes and the 100 randomly selected sample of 100,000 is the number of trials.

To learn more about the binomial probability formula refer to:

https://brainly.com/question/9325204

#SPJ1

Please help will mark Brainly

Answers

The required value of exponential function for the given values of x are 1.43, 1 , 0.7.

What is exponential function?

Calculating the exponential growth or decay of a given collection of data is done using an exponential function, which is a mathematical function. Exponential functions, for instance, can be used to estimate population changes, loan interest rates, bacterial growth, radioactive decay, and disease spread. ​

According to question:

We have,

f(x) = [tex](0.7)^{x}[/tex]

So, at x = -1

f(x) = (0.7)^-1

f(x) = 1.43

At x = 0

f(x) = (0.7)^0

f(x) = 1

At x = 1

f(x) = (0.7)^1

f(x) = (0.7)

Thus, required value of function are 1.43, 1, 0.7

To know more about function visit:

brainly.com/question/28278699

#SPJ1

A store sells two sizes of fresh wreaths. An​ 18-inch wreath costs ​$15​, and a​ 22-inch wreath costs ​$30. In one​ day, the number of​ 22-inch wreaths sold was FOUR more than TWICE the number of​ 18-inch wreaths, for a total of ​$645. How many of each were​ sold?

Answers

The number of​ 18-inch wreaths is 7, and

the number of 22-inch wreaths is 18.

What is a linear equation?

When an algebraic equation is graphed, it always results in a straight line since each term in a linear equation has an exponent of 1. For this reason, it is referred to as a "linear equation."

There are both one-variable and two-variable linear equations.

Given the cost of an 18-inch wreath = $15

cost of a 22-inch wreath = $30

let the number of 18-inch wreaths be x and the number of  22-inch wreaths is y,

the total cost of both wreaths = $645

cost of x 18-inch wreaths = $15x

cost of y  22-inch wreaths = $30y

equation is,

$15x + $30y = $654

and the number of​ 22-inch wreaths sold was four more than twice the number of​ 18-inch wreaths,

y = 4 + 2x

substitute the value of y in the equation

15x + 30y = 645

15x + 30(4 + 2x) = 645

15x + 60x = 645 - 120

75x = 525

x = 525/75

x = 7

and y = 4 + 2x

y = 4 + 2*7

y = 18

Hence store sells 18  22-inch wreaths and 7  18-inch wreaths.

Learn more about linear equations;

https://brainly.com/question/29739212

#SPJ1

h(n)=2/n -2 solve inverse function

Answers

Answer:

2/n+2

Step-by-step explanation:

please try on this and please give explanation

Answers

Answer: In the figure above, clearly the line L is perpendicular to x-axis and passing through the value 'c' on x- axis. So, the equation of a line perpendicular to x axis is x = c

Select the 2 fractions that are equivalent to 1

Answers

Answer: Anything that has the same two numbers

Step-by-step explanation:

You don't have a picture, so I'm basing this off of what I know. A number over another number that is the same is equivalent to one.

TEXT ANSWER
A dog weighs 45 pounds 12 ounces. How much does the dog weigh in kilograms?
If needed, round your answer to the nearest hundredth.
Conversion ratios:
• 1 lb = 16 oz
1 kg = 2.2 lb
Use the equation editor to show your work.
.

Answers

Answer:

20,45 kg,

Step-by-step explanation:

45  Lb * (1 kg / 2,2 Lb) + (12 Austrália * (1 kg / 35 ,2 Austrália)) = 20,45 kg

Um resposta é 20,45 kg.

a project consists of 150 jobs. the expected completion time for each job is given in days. the project has three critical paths with two jobs in common, j and k. in order to finish the project one day early, the completion time should be reduced one day for

Answers

Reducing the completion average  time for Jobs J and K by one day will shorten the overall project completion time by one day, allowing the project to finish one day early.

In order to finish the project one day early, the completion time for Jobs J and K should be reduced by one day. This is because these two jobs are part of the three critical paths of the project. By reducing the completion time for these two jobs by one day, the entire project will be completed one day early. This is because the critical paths are the paths that will determine the overall project completion time. By reducing the completion time for these two jobs, the overall project completion time will be shortened. This will allow the project to be finished one day earlier than expected.

Learn more about average here

https://brainly.com/question/24057012

#SPJ4

which of the following is equivalent to the probability of less than 50% democrats in a sample size of

Answers

Probability of less than 50 % democrats for the example based on sample proportion is equal to 0.1562.

Sample size 'n' = 100

Registered voters  'p' = 55%

                                    = 0.55

σ = √ p( 1- p )/ n

  = √0.55( 0.45)/ 100

  = 0.04975

Mean 'μ' = 55%

               = 0.55

Probability of getting less than 50% democrats in a sample size of 100 voters

X = 0.5

Z = ( X - μ ) / σ

  = ( 0.5 - 0.55) / 0.4975

 = -1. 005

 = -1.01

p-value pf -1.01 is equal to 0.156248

Therefore, the probability of getting 50% democrats for the given sample size id equal to 0.1562. The given example represents sample proportion.

The above question is incomplete , the complete question is :

In a congressional district, 55% of the registered voters are Democrats. Which of the following is closest to the probability of getting less than 50% Democrats in a random sample of size 100?

Is this an example of a sample proportion OR a sample mean?

Learn more about probability here

brainly.com/question/30034780

#SPJ4

Other Questions
a client who is taking an oral hypoglycemic daily for type 2 diabetes develops an infection with anorexia. which advice will the nurse provide to the client? a solution is prepared at that is initially in dimethylamine , a weak base with , and in dimethylammonium bromide . calculate the ph of the solution. round your answer to decimal places. find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange. according to the proponents of the quantity theory of money, can a change in the money supply m cause a change in the level of real gross domestic product y? this graph shows merchandise export data for the years 2010 through 2012. a graph titled total merchandise exports from 2010 to 2012 has year on the x-axis and exports in trillions of u s dollars on the y-axis, from 0 to 2.5 in increments of 0.5. a line representing united notes exports is slightly lower than a line representing china exports. which statement most accurately describes the information presented on the graph? during the 21st century, the complexity of the challenges posed by disruptive, digital technologies and accelerating rates of change has encouraged companies to: In order to maintain compliance with standard precautions, a medical assistant should recognize that which of the following tasks requires the use of gloves despite the absence of any visible blood?a) Administering a nebulizer treatmentb) Performing a visual acuity testc) Obtaining a tympanic readingd) Removing a cyst italian sailor credited with the discovery of the americas in 1492. true or false The key idea of John Locke's Enlightenment theory was to protect and enhance the freedoms and rights of O the government. O the philosophers. O the law. O the individual. A group of four friends spends a day at a local theme park, which has just opened a new attraction with very popular rides featuring new technology. They board one of the rides after waiting for over an hour in line, but about five minutes into the ride the electricity fails, and they are stuck on the ride for a half hour. When the ride finally resumes and concludes, they go to the theme parks guest services department to complain. What are the facts?How does the guest feel?How would you acknowledge the guests feelings?What would be your solution?How would you follow up with the guest? Read this quotation from paragraph 10."What could happen if you allowed yourself to step outside the cages and breathe in the fresh air of your freedom?"Based on the quotation, the author views her high-school years as a source of - A. transitionB. confinementC. orderD. discipline