1) f(x) = x(x − 4)³(x+4)²
x-intercepts:
Positive or Negative
Even or Odd
End Behavior:

Answers

Answer 1

The given function has

x-intercepts: x = 0, x = 4, x = -4, x = -4i and x = 4i.

Positive or Negative:  The function f(x) = x(x − 4)³(x+4)² is positive for x > 0 and negative for x < 0.

Even or Odd: The function f(x) = x(x − 4)³(x+4)² is an even function.

End behavior: x approaches positive or negative infinity the value of f(x) approaches positive infinity.

What is a function?

A function is a mathematical relationship between a set of inputs (referred to as the domain) and a set of outputs (referred to as the range). In other words, a function assigns a unique output to each input value in the domain.

Given the function f(x) = x(x − 4)³(x+4)²

x-intercepts: The x-intercepts are the points at which the function crosses the x-axis, meaning the y value is equal to zero. To find the x-intercepts we need to set f(x) = 0 and solve for x.

x(x - 4)^3(x+4)^2 = 0

the x-intercepts of the function f(x) = x(x - 4)^3(x+4)^2 are x = 0, x = 4, x = -4, x = -4i and x = 4i.

Positive or Negative: The function f(x) = x(x − 4)³(x+4)² is positive for x > 0 and negative for x < 0.

Even or Odd: The function f(x) = x(x − 4)³(x+4)² is an even function.

End Behavior: The end behavior of this function is that as x approaches positive or negative infinity the value of f(x) approaches positive infinity.

Hence, the given function has

x-intercepts: x = 0, x = 4, x = -4, x = -4i and x = 4i.

Positive or Negative:  The function f(x) = x(x − 4)³(x+4)² is positive for x > 0 and negative for x < 0.

Even or Odd: The function f(x) = x(x − 4)³(x+4)² is an even function.

End behavior: x approaches positive or negative infinity the value of f(x) approaches positive infinity.

To learn more about the functions, visit:

https://brainly.com/question/17043948

#SPJ1


Related Questions

On the curve y=x/3 , point P has coordinates (2, 0.667). What is the slope of the curve at point P?

A. 0.033
B. 0.067
C. 0.333
D. 0.667

Answers

The correct option regarding the slope of the linear function at point P is given as follows:

C. 0.333.

How to obtain the slope of the linear function?

The slope-intercept definition of a linear function is given as follows:

y = mx + b.

In which:

The slope m represents the rate of change.The intercept b represents the value of y when x = 0.

The line in this problem is defined as follows:

y = x/3.

Meaning that:

The slope is of 1/3.The intercept is of 0.

The slope is the same for each point on the curve, hence the correct option is given by option C.

More can be learned about linear functions at brainly.com/question/24808124

#SPJ1


MP Attend to Precision Denise needs 4 pounds of soil
to fill a flowerpot. She has a bag with 2 pounds of soil
and a box with 13 pounds of soil. Does Denise have enough
soil to fill the flowerpot? Explain.

Answers

As she have 3⅞ pounds of soil, she doesn't have enough soil to fill the flowerpot.

What is mixed fraction?

To create a mixed fraction, a suitable fraction and a whole number must be combined. Usually, it denotes a value between 0 and 1. A mixed fraction is one that contains both a whole number and a fraction. One example of a mixed fraction is 1(1/3), where 1 is a whole number and 1/3 is a fraction.

Denise need 4 pounds of soil

By adding the mixed fraction we will know if its enough or not

[tex]$=1\frac{3}{4} + 2 \frac{1}{8}[/tex]

[tex]$=\frac{7}{4} + \frac{17}{8}[/tex]

[tex]$=\frac{14}{8} + \frac{17}{8}[/tex]

[tex]$=\frac{14+17}{8}[/tex]

[tex]= \dfrac{31}{8}[/tex]

[tex]=3 \dfrac{7}{8}[/tex]

Thus, As she have 3⅞ pounds of soil, she doesn't have enough soil to fill the flowerpot.

Learn more about mixed fraction

https://brainly.com/question/29264210

#SPJ1

An ordinary (fair) die is a cube with the numbers 1 through 6 on the sides (represented by painted spots). Imagine that such a die is rolled twice in succession
and that the face values of the two rolls are added together. This sum is recorded as the outcome of a single trial of a random experiment.
Compute the probability of each of the following events.
Event A: The sum is greater than 9.
Event B: The sum is not divisible by 2 and not divisible by 5.
Round your answers to two decimal places.
(a) P(A) = 11.1
(b) P (B) =

Answers

The probability of each of the following events are given below:

What is Probability?

Probability is the measure of the likelihood that an event will occur. It is expressed as a number between 0 and 1, with 0 representing no chance of the event occurring, and 1 representing a certainty that the event will occur. Probability is widely used in mathematics, statistics, and science to calculate the probability of a given event occurring. It is also used to assess risk and uncertainty in decision-making.

Event A: 0.306 or 30.6%

Event B: 0.44 or 44%.

Event A: The sum is greater than 9.

We have already computed this, the probability of getting a sum greater than 9 is 11/36, which can be simplified as 0.306 or 30.6%

Event B: The sum is not divisible by 2 and not divisible by 5.

To find the probability of this event, we need to find the number of outcomes that have a sum that is not divisible by 2 or 5.

We can calculate this by listing out all the possible outcomes and counting the number that have a sum that is not divisible by 2 or 5: (1,3), (1,4), (1,6), (2,3), (2,5), (3,1), (3,2), (3,4), (3,6), (4,1), (4,3), (4,5), (5,2), (5,4), (6,1), (6,3), (6,4) and (6,6)

There are 16 outcomes that have a sum that is not divisible by 2 or 5, so the probability of getting a sum that is not divisible by 2 or 5 is 16/36, which can be simplified as 0.44 or 44%.

To learn more about Probability, Visit

brainly.com/question/24756209

#SPJ1

What is the ratio of red apples to all apples in the basket?

What is the ratio of red apples to green apples?

Answers

Answer: a) 8:6

              b) 8:14

Step-by-step explanation:

You got the answer correct for a but you have to switch the numbers around because the ratio of red apple to green apples is 8:6

find the inverse of 8x^5+7

Answers

The inverse of a function is another function that "undoes" the original function. In other words, the composition of a function and its inverse results in the identity function.

To find the inverse of a function, you can follow these steps:

Replace the function with "y"

Switch the x and y variables

Solve for y (or in this case x)

So in this case, we can find the inverse of 8x^5+7 by replacing y with 8x^5+7, switching the x and y variables, and solving for x:

y = 8x^5+7

x = 8y^5+7

This is not an invertible function because it's not a one-to-one function, it's not a function of x.

Answer:

Hey there! The inverse of 8x^5+7 doesn't exist because it's not a function. Think about it like this, a function is like a machine that takes an input and gives you a unique output. But in this case, the machine isn't working correctly and it doesn't give you a unique output for a given input. So, in simple terms, it doesn't have an inverse.

________________________________________________________

How do you determine if an equation has an inverse?

To determine if an equation has an inverse, we need to check if it is a one-to-one function. A one-to-one function is a function in which every unique input corresponds to a unique output. If an equation is one-to-one function, then it has an inverse. If it's not one-to-one function, then it doesn't have an inverse.

How do you find the inverse of a linear equation?

To find the inverse of a linear equation, we can follow these steps:

1. Switch the x and y variables

2. Solve for y (or x)

3. Replace y (or x) with f^-1 (x) (or f^-1 (y))

For example, if we have the equation y = 2x+1, we can follow these steps:

1. x = 2y+1

2. x-1 = 2y

3. f^-1(x) = (x-1)/2

So, the inverse of the equation y = 2x+1 is f^-1(x) = (x-1)/2

the distance around a standard tennis court is 228 feet. if the length of the court is 30 feet more than twice the width, find the dimensions of the tennis court

Answers

The dimensions of the tennis court are 42 feet by 114 feet.

Let the width of the tennis court be x feet.

We can use the formula for perimeter to solve this problem. The perimeter of a rectangle is equal to 2 times the length plus 2 times the width.

2(2x + 30) + 2x = 228

4x + 60 = 228

4x = 168

x = 42

The length of the tennis court is 2x + 30 = 2(42) + 30 = 114 feet.

The dimensions of the tennis court are 42 feet by 114 feet.

Learn more about perimeter of a rectangle here:

https://brainly.com/question/29595517

#SPJ4

Plot the image of point QQQ under the translation (x,y)\to(x+1,y+2)(x,y)→(x+1,y+2)left parenthesis, x, comma, y, right parenthesis, \to, left parenthesis, x, plus, 1, comma, y, plus, 2, right parenthesis.

Answers

The coordinates of the image of the point Q is Q'(3, 6).

What is Geometric Transformation?

Transformation of geometrical figures or points is the manipulation of a given figure to some other way.

Different types of transformations are Rotation, Reflection, Glide reflection, Translation and Dilation.

From the given graph, we have point Q(-4, 4).

Here the point is translated.

After translation, the original figure is shifted from a place to another place without affecting it's size.

The rule of translation is given as the point (x, y) is translated as (x + 1, y + 2).

So the given point is (-4, 4).

(-4, 4) after translation becomes by the definition (-4 + 1, 4 + 2).

So the required point is (-3, 6).

Hence the image of point Q is (-3, 6).

To learn more about Translation, click on the link given below :

https://brainly.com/question/12463306

#SPJ1

Your question is incomplete, Probably, the correct graph for the question is given below.


Select all ratios equivalent to 12:6.
10:5 18:9 11:2

Answers

The ratios that are equivalent to 12:6 are (a) 10 : 5 and (b) 18 : 9

How to determine the equivalent ratio

From the question, we have the following parameters that can be used in our computation:

Ratio = 12 : 6

Divide both sides of this ratio by 6

So, we have the following representation

Ratio = 2 : 1

Multiply the ratio by 9

Ratio = 18 : 9

Multiply the ratio by 5

Ratio = 10 : 5

Hence, the equivalent ratios are 10:5 and 18:9

Read more about ratio at:

https://brainly.com/question/1781657

#SPJ1

What number after being increased by 22% results in a value of 305 round your answer to the nearest hundredth if necessary

Answers

According to the given information in the question answer is  250.

What does "rounding to the nearest hundredth" actually mean?

Any decimal number is rounded down to the closest hundredth by the term "to the nearest hundredth." A hundredth is 1/100 or 0.01 in decimal form. For instance, increasing 2.167 to the closest tenth yields 2.17.

To the closest hundredth, what is 10.2719?

In this exercise, we must round the supplied number up to the nearest hundred, making it 10.2719. We must add two more decimal places to this number in order to round it to the nearest hundreds. Additionally, we saw that all of the numbers following the second decimal place are fewer than five, therefore they can be ignored and the result is 10.27.

Using the following formula, you can determine this:

x = (100 * 305) / 122

Where x is the original number and 122 is 100 + 22 (the 100 representing the original value and 22 representing the increase of 22%).

x = (100 * 305) / 122 = 250

To know more about nearest hundredth visit:

https://brainly.com/question/809709

#SPJ1

The angle of depression from the top of a cliff to a nearby town is 10 degrees.



If the top of the cliff is 354 feet above the town, how far is the town from the base of the cliff?

Answers

The distance of the town from the base of the cliff  is; 62.42 ft

How to use trigonometric ratios?

The 6 trigonometric ratios are;

sin θ = opposite/hypotenuse

cos θ = adjacent/hypotenuse

tan θ = opposite/ adjacent

sec θ = 1/cos θ

cosec θ = 1/sin θ

cot θ = 1/cot θ

We are given the angle of depression as 10 degrees. By definition of alternate angles, the angle the hypotenuse formed will make with the base of the town is 10 degrees.

Since the height from the cliff to the town is 354 ft, then we can use trigonometric ratio to find the distance of the town from the base of the cliff as;

354/adjacent = tan 10

adjacent = 354 * tan 10

adjacent = 62.42 ft

Read more about trigonometric ratios at; https://brainly.com/question/13276558

#SPJ1

You are standing 143 feet away from the base of a building and your clinometer measures 17° when it’s looking at the top of the building. (This angle is the one between the ground and the top of the building). Please calculate the height of the building.

Answers

Answer:

43.7 ft

Step-by-step explanation:

h= height of the building

tan(17) = h/143

h = tan(17) x 143 = 43.7 ft

square corners, 5 units on a side, are removed from a 20 unit by 30 unit rectangular sheet of cardboard. the sides are then folded to form an open box. the surface area, in square units, of the interior of the box is

Answers

The surface area of the interior of the box is the total area of the interior walls of the box.

This can be calculated by subtracting the area of the 5 unit square removed from the total area of the original 20 by 30 unit rectangular sheet of cardboard. This gives us an area of 450 units. To calculate the area of the interior walls, we need to multiply the length and width of the remaining rectangle. This gives us a length of 15 units and a width of 25 units, which gives us a total area of 375 units. Therefore, the surface area of the interior of the box is 375 square units. We can calculate this using the formula A = L x W, where A represents the area, L represents the length and W represents the width.

Learn more about surface area here:

https://brainly.com/question/29298005

#SPJ4

What is the percent of decrease from 100 to 60?

Answers

Answer:

40% decrease

Step-by-step explanation:

since it is 100 it is easy to convert to a percentage. 100-60=40 so you have a 40% decrease

1. If SW = 25 and ST = 24, find the area of rectangle RSTW.

2. If SZ = 25 and WT = 14, what is ST?

Answers

1. Using the Pythagoras theorem, the area of the rectangle RSTW is 168 units².

2. Using the Pythagoras theorem, the measure of line segment ST is 48 units.

What is Pythagoras Theorem?

In a right-angled triangle, the square of the hypotenuse side is equal to the sum of the squares of the other two sides, according to Pythagoras's Theorem. These triangle's three sides are known as the Perpendicular, Base, and Hypotenuse. Due to its position opposite the 90° angle, the hypotenuse in this case is the longest side.

The diagonal SW measures = 25 units

The breadth ST measures = 24 units.

Applying the Pythagoras theorem -

(Hypotenuse)² = (Base)² + (Perpendicular)²

Substituting the values in the equation -

(SW)² = (ST)² + (WT)²

(25)² = (24)² + (WT)²

(WT)² = (25)² - (24)²

(WT)² = 625 - 576

(WT)² = 49

WT = √49

WT = 7 units

The length WT measures = 7 units

The formula for the area of the rectangle is -

Area = Length × Breadth

Area = WT × ST

Area = 7 × 24

Area = 168 units²

Therefore, the area of the rectangle is obtained as 168 units².

The line segment SZ measures = 25 units

According to the properties of rectangle the diagonals bisect each other.

So, the measure of SW = 2(SZ) = 50 units

The length WT measures = 14 units

Applying the Pythagoras theorem -

(Hypotenuse)² = (Base)² + (Perpendicular)²

Substituting the values in the equation -

(SW)² = (ST)² + (WT)²

(50)² = (ST)² + (14)²

(ST)² = (50)² - (14)²

(ST)² = 2500 - 196

(ST)² = 2304

ST = √2304

ST = 48 units

Therefore, the breadth ST measures = 48 units.

To learn more about Pythagoras Theorem from the given link

https://brainly.com/question/21970437

#SPJ1

Principal 1,565.89 1,026.44
Interest 20.55 13.47
Payment 560.00
End of the month balance 1,026.44

Answers

The annual percentage rate for this credit card account is 15.75%.

How is the annual percentage rate determined?

The annual percentage rate (APR) is the actual annual cost of borrowing money.

Before applying the APR on the account balance, we determine the monthly percentage rate (MPR) by dividing the APR by 12.

Given the interest in dollars and the principal or account balance, the APR can be computed by dividing the interest by the account balance and multiplying it by 12.

Principal        $1,565.89       $1,026.44

Interest                20.55               13.47

Payment           560.00

End of the month balance 1,026.44

Interest rate (MPR) = 1.31235% ($20.55/$1,565.89 x 100)

Annual percentage rate = 15.75% (1.31235% x 12)

Learn more about the annual percentage rate at https://brainly.com/question/24715857

#SPJ1

Question Completion:

What is the annual percentage rate?

The picture shows six equal squares. The total is 54ft2. What is the perimeter?

Answers

Answer:

72ft

Step-by-step explanation:

Area of one square = 54ft^2/6 = 9ft^2

The side of the square is the square root of the area, so the side length of one square is

√9ft^2 = 3ft.

each square has a perimeter of

4*3ft = 12ft.

So the perimeter of all six squares is

12ft * 6 = 72ft

The mean is calculated for for 551 respondents and the result is 1.5

Answers

The level of measurement of the data can be given as follows:

Interval or ratio.

How to obtain the levels of measurement of the data?

There are four levels of measurement for the data, given as follows:

Nominal.Ordinal.Interval.Ratios.

The measures of central tendency for each level are given as follows:

Nominal: ModeOrdinal: Mode and median.Interval: Arithmetic mean, mode and median.Ratios: Arithmetic mean, geometric mean, mode and median.

For this problem, we have the arithmetic mean, meaning that the level of measurement can be either interval or ratio.

Missing Information

The problem asks for the level of measurement of the data.

More can be learned about level of measurement at https://brainly.com/question/17227965

#SPJ1

A restaurant server believes the distribution of their tips has a model that is slightly skewed to the left, with a mean of $10.70 and a standard deviation of $6.70. They
usually wait on about 60 parties over a weekend of work.
a) Estimate the probability that they will earn at least $800 in tips.
b) How much do they earn on the best 10% of such weekends?

Answers

Answer:

a) To estimate the probability that the server will earn at least $800 in tips, we need to use the cumulative distribution function (CDF) of the normal distribution, since the mean and standard deviation of the tips are given. The CDF of the normal distribution with mean μ and standard deviation σ is given by F(x) = P(X <= x) = (1/2)(1 + erf((x-μ)/(σ * sqrt(2)))

We can use this formula to find the probability that the server will earn at least $800 in tips. We know that the mean of the tips is $10.70, and the standard deviation is $6.70. Therefore, we can calculate the CDF of the normal distribution with μ = $10.70 and σ = $6.70.

P(X >= 800) = 1 - P(X <= 800) = 1 - F(800)

b) To find out how much the server earns on the best 10% of such weekends, we need to find out what the 90th percentile of the distribution is. We can use the inverse cumulative distribution function (ICDF) of the normal distribution to find this. The ICDF of the normal distribution with mean μ and standard deviation σ is given by x = μ + σ * sqrt(2) * erf^-1(2F(x) - 1)

We know that the mean of the tips is $10.70, and the standard deviation is $6.70. Therefore, we can calculate the ICDF of the normal distribution with μ = $10.70 and σ = $6.70.

Then we can find the 90th percentile: x = $10.70 + $6.70 * sqrt(2) * erf^-1(2*0.1 - 1)

Please note that the above calculation required erf^-1(inverse error function) which is not a standard function on most calculators, you may need to use a software/programming language to find it.

I need help with this equation nowww

Answers

The new coordinate of Q after a rotation of 90° is (10, -5)

How to determine the new coordinate of Q after a rotation of 90°?

Rotation simply means turning

In order to answer this question, you need to know the rotation rule  for  90° about the origin.

If a point P, whose position vector is (x,y), is rotated 90° counterclockwise rotation about the origin, the position of the image P' is (-y, x).

From the graph, the initial coordinate of Q is (-5, -10).

Thus, the new coordinate of Q will be (10, -5)

Learn more about rotation on:

brainly.com/question/21850160

#SPJ1

Anything would be awesome!

Answers

The composition with rotation to map ΔABC to ΔA'B'C' is;

Reflection across the y-axis and 270 degrees counterclockise rotation about the origin

How to interpret Rotation transformation?

A rotation is defined as a type of transformation that takes each point in a figure and rotates it to a specific number of degrees around a given point.

Now, the coordinates of triangle ABC from the graph are;

A(-8, -2)

B(-6, 3)

C(-5, -1)

The coordinates of triangle A'B'C' from the graph are;

A(-2, -8)

B(3, -6)

C(-1, -5)

Now, the transformation rule for reflection across the y -axis is (x, y) → (-x, y) .

Finally rotation 270 degrees counterclockwise will produce;

(-x, y) → (y, x)

Read more about Rotation Transformation at; https://brainly.com/question/4289712

#SPJ1

What is the answer to the equation
Z - 2/5=1/3

Answers

Answer:

To solve the equation Z - 2/5=1/3, we need to get Z alone on one side of the equation.

First we add 2/5 to both sides of the equation to get

Z - 2/5 + 2/5 = 1/3 + 2/5

Z = 1/3 + 2/5

To combine the fractions on the right side of the equation, we need to find a common denominator.

The common denominator of 1/3 and 2/5 is 15

So we can convert 2/5 to 9/15

Z = 1/3 + 9/15

Now we can add the fractions

Z = 12/15 + 9/15

Z = 21/15

So the solution to the equation is Z = 21/15

Step-by-step explanation:

Determine the number of classes in the frequency table below.
Class | Frequency
23-24 , 7
25-26 , 2
27-28 , 6
29-30 , 4
31-32 , 1

Answers

The number of classes in the frequency table given below is; 5 classes

How to Interpret a Frequency Table?

We are given the classes of the frequency table as;

23 - 24

25 - 26

27 - 28

29 - 30

31 - 32

Now, we see from the class intervals that there are a total of five classes because each class interval has a frequency of occurrence as seen in the given frequency table.

The frequencies for each class interval is as follows;

7, 2, 6, 4, 1

Read more about Frequency Table at; https://brainly.com/question/16148316

#SPJ1

What is the Product? ​

Answers

The product meaning in maths is a number that we get to by multiplying two or more other numbers together.

What is Product?

In mathematics, a product is the outcome of multiplying two or more numbers together.

Let us consider the scenario.  A person had to buy 4 cupcakes. Each cupcake costs $5.

To calculate the total amount he needs to pay at the checkout counter, add the cost of each cupcake 4 times (as he needs to buy 4 cupcakes).

So, the answer will be -

5 + 5 + 5 + 5 = 20

If he needed 10 cupcakes, he would have to add the cost 10 times.

This is where the concept of multiplication and product can help him.

He can find the cost as -

4 times 5 or 4 × 5,

He can skip count by 5, four times and get the answer as 20.

Therefore, product is repetition for the sum of numbers.

To learn more about Product from the given link

https://brainly.com/question/25922327

#SPJ1

Oil is leaking from an oil tanker at the rate of 3000 liters per hour. 8 liters of oil spread out over 10 square meters of ocean surface.

Answers

a) The radius of the area of the oil leakage is described by R = √(112.345 · t).

b) The time related to a radius 1 kilometers is approximately 8901.153 hours.

How to analyze an oil leakage from oil tanker

In this problem an oil tanker has a leakage on ocean surface, the consequence of such event is a contaminated area of circular form, whose formula is described below:

A = π · R²

Where:

A - Area, in square meters. R - Radius, in meters.

And the area density (σ), in liters per square meter, is defined by following formula:

V = σ · A

Where V is the volume leaked, in liters, whose formula is described:

V = V' · t

Where:

V' - Leaking rate, in liters per hour.t - Time, in hour.

Part A - The resulting expression in terms of time is shown below:

V = σ · A

V' · t = σ · π · R²

R = √[(V' · t) / (σ · π)]

(V' = 3000 L / h, σ = 4 / 5 L / m²)

R = √[(3000 · t) / (8.5π)]

R = √(112.345 · t)

Part B - If we know that R = 1000 m, then the time needed is:

1000 = √(112.345 · t)

t = 8901.153 h

Remark

Statement is incomplete. Complete form is shown below:

Oil is leaking from an oil tanker at the tanker of 3000 liters per hour. 8 liters of oil spread out over 10 square meter of ocean surface. A circular oil slick forms.

a) Express the radius R of the oil slick as a function of the time t (in hours) the tank has been leaking.

b) After how many hours will the oil slick have radius 1 kilometer?

To learn more on rates of change: https://brainly.com/question/13652075

#SPJ1

Three partners share a business. Max owns 3 8 , Sherry owns 2 5 , and Duane owns the rest. If the profits this year are $350,000, how much does each partner receive (in $)?

Answers

answer:

Max =$131,250

Sherry=$140,000

Duane=$78,750

Step-by-step explanation:

Max will receive 3/8 ×$350,000=$131,250

Sherry will receive 2/5 × $350,000=$140,000

Duane will receive $350,000-$(131,250+140,000)

$350,000-$271,250=$78,750.

What is the arc of WY

Answers

The angle ∠G will be 140° for the given curve.

What is the arc of the circle?

An arc is a section of a circle's or curve's boundary in mathematics. It is additionally known as an open curve. The circumference also referred to as the perimeter, is the measurement around a circle that defines its edge.

Given that the angle ∠I is equal to 70°. The value of angle G will be calculated by the angle of the arc theorem.

One-half the size of the central angle is the size of an angle that is inscribed in a circle. Congruent inscribed angles are those that intersect the same arc.

∠I = ( 1 / 2 ) x ∠G

∠G = 2 x ∠I

∠G = 2 x 70

∠G = 140

Hence, the angle ∠G will be 140.

To know more about the inscribed angle theorem follow

https://brainly.com/question/3538263

#SPJ1

Which of the following is most likely the next step in the series?

Answers

Answer:

Choice C. is the answer

Step-by-step explanation:

greetings !!

just following the series the

First starts with simple square which have four sides.The second have five sides which is a Pentagon.The third one will have a hexagon or six side shape.Then, finally it will be preceded by a heptagon which is a seven sided have in regard to the series.

If any questions and unclear ideas tag on comment box.

Hope it helps!!!

The function f(x)=x is translated 4 units left and 3 units up. Which function represents the transformation?

Answers

A function that represents the transformation include the following: B. g(x) = (x + 4) + 3.

What is a translation?

In Mathematics, the translation of a geometric figure or graph to the left simply means subtracting a digit from the value on the x-coordinate of the pre-image or function.

Conversely, the translation a geometric figure or graph upward simply means subtracting a digit from the value on the y-coordinate (y-axis) of the pre-image or function.

By translating the pre-image vertically upward by 3 units and horizontally left by 4 units, the function becomes;

f(x) = x

f(x) → g(x) = (x + 4) + 3.

Read more on translation here: brainly.com/question/20720324

#SPJ1

How do I do this problem I do not get it do I add when I found the volume of both

Answers

Answer: 149 cm^3

To find the volume for a cube, the formula is V = a^3, where a = length of one side.

Smaller cube:

a = 3

(3)^3, or 3 x 3 x 3

= 27 cm^3

Larger cube:

a = 5

(5)^3, or 5 x 5 x 5

= 125 cm^3

To find the volume of the entire sculpture, add the volumes of each of the cubes.

27 + 125

= 149 cm^3

the sum of 6 and the square of 12

the quotient of 30 and the sum of 5 and 7

the difference of 4 cubed and 25

5 more than the product of 12 and 8

Answers

The solutions are 150, 2.5, 39 and 101. The solutions have been obtained using the arithmetic operations.

What are arithmetic operations?

In all, there are four basic mathematical operations which are applicable for all the real number. The operations are as follows:

1.Addition(‘+’) operation which gives the sum of the numbers.

2.Subtraction(‘-’) operation which gives the difference of the numbers.

3.Multiplication(‘×’) operation which gives the product of the numbers.

4.Division(‘÷’) operation which gives the quotient of the numbers.

1. The sum of 6 and the square of 12

The square of 12 = 12*12 = 144

Sum of 6 and 144 = 6 + 144 = 150

2. The quotient of 30 and the sum of 5 and 7

The sum of 5 and 7 = 5 + 7 = 12

The quotient of 30 and 12 = 30 ÷ 12 = 2.5

3. The difference of 4 cubed and 25

The cube of 4 = 4*4*4 = 64

The difference of 64 and 25 = 64 - 25 = 39

4. 5 more than the product of 12 and 8

The product of 12 and 8 = 12*8 = 96

5 more than 96 = 5 + 96 = 101

Hence, the solutions are 150, 2.5, 39 and 101.

Learn more about arithmetic operations from the given link

https://brainly.com/question/30283549

#SPJ1

Other Questions
A member of one species (the predator) feeds directly on all or part of a living organism (the prey) as part of the food web. Randomly selecting 20 cards out of 52 card deck, the probability of each outcome will be basically the same whether it is done with or without replacement 1TRUE OR FALSE? 1. 50cm of 0.5 mol/dm NaOH solution and 50cm of 0.5mol/dm HNO3 were mixed at 20c and stirred in a calorimeter with negligible heat capacity. The temperature of the mixture rose to 23.2c.the density of each solution is 1.0g/cm and the specific heat capacity of each solution is 4.18J/K/g.calculatei.the enthalpy for the neutralizationii.calculate the change in enthalpy per mole of water formed last year small manufacturing company netted $540,000 the net profit increased this year by 135% what is the net profit of the company this year Becky had net sales (all on account) in 2017 of $820000. At December 31, 2017, before adjusting entries, the balances in selected accounts were: accounts receivable $1000000 debit, and allowance for doubtful accounts $2120 debit. Becky estimates that 2% of its accounts receivable will prove to be uncollectible. What is the net realizable value of the receivables reported on the financial statements at December 31, 2017 there are 10 employees in a particular division of a company. their salaries have a mean of $70,000, a median of $55,000, and a standard de?viation of $60,000. the largest number on the list is $ 100,000. by accident, this number is changed to $ 1,000,000. which nims structure develops recommends and executes public information Using y = 6 - 2x, plot the ordered pairs from the table. Then graph the function represented by the ordered pairs and tell whether the function is linear or nonlinear. Part 1 out of 3 Complete the table. Input, x Output, y Check -1 3 Next a client who is taking an oral hypoglycemic daily for type 2 diabetes develops an infection with anorexia. which advice will the nurse provide to the client? a solution is prepared at that is initially in dimethylamine , a weak base with , and in dimethylammonium bromide . calculate the ph of the solution. round your answer to decimal places. find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange.